Description :
From Genome Similarity Track
Location :
Scaffold_147:49787- 51993
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_147-snap-gene-0.29Myosin

Sequence
2206 bases(100 bases per row)
CGACAGGCGCAGAGGACATGTGTGAACTGCACCACTTACATGAACCTGCGATTGTATACAACGTACGTGATCGTTTCTTTGCTCAAGCGCCATACACATA
CACTGGCAAGATCGTTGTGGCTGTGAACCCATATCGGTGGATCAAGCCACTGTACACTGAAGAACTGCGTGAACTCTACACCAAATACTCcGgTGAATCT
TTGCCTCCGCACgTGTACGCAACCAGTGCTGAGGCGTTCCACAACATGAAGAACcACCGAATTCCGCAGAGtATTTTGGtGAGcGGTGAGTCCGGCGCAG
GTAAGACTGAGACCGTCAAGATTAtGATGGAGCATCTCGCCAGTATCTCCATGTCGTACGCGAGCCAGCTGAAAGCAAAACATGGATCGAATGGGGATGC
GAAGCAATATTCGACGGGTCATCACAGCATCGTTGAGAAGGTACTCAAGAGTAACCCgCTGCTTGAAGCTTTCGGTAACGCCAAGACCATTCGTAACGAC
AACTCAAGTCGATTCGGCAAGTTCACCCAGCTTCATTTTAGCTCCGACTATTGCCTTGTCGGCGCCGAGTGTCGTCATTATTTGTTGGAGAAGTCCCGTG
TTGTCCACCAGTCGGCTGGTGAACGCAACTACCACATCTTCTATCAGCTTGTCAGTGCTCACGAAGAGAAGTACGGCTTTTCGAACGATTCCTCTGCCCG
CGATTTCCGTTATCTCCAAGATGAAGAGCTGGTTCTCGATGGTCAGACCGATTTGGAGCGTTATCAAGTGACATGTGATGCCCTCTCAACAATCGGTGTA
TCGGATAGTGAACAGGATGACTTGTTCAAAGCCTTGTGTGGTGTCCTTCGGTTGGGAGAACTAGAGTTCGTTCCGCTTGAATCCGACAAGAACGACTCAA
GTCAACCCGTCGCCTCACTTGACCCTGATAACGAAAGTCAGGAGCAGCAGAAGCTTATCGAAGACCAACAGCGCCATATCAAGACGTGCGCCGAATTGTT
GGGCGTGGAAGTCGCAACATTAGGGCAAAAAATGTGCAGCCGCACAGTCCGAGCGCGTCAAGAGGTTTACAGCGTTCCACTTTCTGCTCTTCAAGCCGGA
AACAACCGCGACGCACTCGCTAAGGAGTTATATGCCCGATTGTTCGCGTACCTCGTGCGCCGAGTCAACAACAGCATTTCTGGTTCGATGAAGTCTGCGA
AGTCTCCGTCCTATCTTCACATCGATCTGCTTGATATCTTtGGTTTTGAATCTTTCAAGCGAAACAGCTTCGAGCAATTTTGCATCAACTTCGCCAATGA
GAAGCTGCAACAGAAGTTTACATTAGACGTATTCAAAACTGTTCAAGAGGAGTACACCAAGGAACAAGTTGGCTGGGAATTCGTGAAGTTCAAGGATAAT
CAGGATATGCTCGAtCTGCTTGAGAACTCGATGGGTGTTATGGCTCTTCTCAACGAGGAGTGTGTTCGTCCAATGGGAAGCGACGTATCGTTTGTATCTA
AAGTCGTGTCGCTTCATGACGGTCATCCAAGGTTGGAGAAGGCACGTCTGAGCCAGACTCAGTTTTTGCTTCAGCATTACGCCGGTCCCGTCACATATGA
TGCCGAAGGGTTTGTTGAGAAGAATCGCGATTCTCTTCAATCAGACCTTCTGGACCTACTTGCGAAGAGTAGCAACGCCCTCATCGCTGGTATTTTCGGT
GCGCGGTATACAGATGATGACTTGGCCGCAGTGTTCGCTGCCGCTACATCGGATGACGGTCGCCGAAGCTCTACTGGGCGCAAGACATCAACATTCATGC
AAGAAACGGTTAGCTACAAGTTCAAGGCTCAACTTGCTCTTCTCATGAGCGACATTTCTGCCACTGAAGTCCATTACGTCCGTTGCATCAAGCCGAACTC
CAAGAAGAGTCCTCACTCgTACGAAATTGACGCTGTTGTGAATCAGCTTCGTTATGCAGGCGTGATCGAAGCGATTCGAATTACTCGTGCGGCTTTCCCC
AACAAAATGAGCCATGAGAAATTTCTCCGTCGTTTCGTGCTACTCAAAGATGAGGCTGAGGAGACCATTTCGGATTCCACGGCTGCAGCAGCATGCGAGA
AGCTAGTGGCAACGCTTCTCGGCAAGGACTTCAAGAGGCCAGACGAAGATGATACAACGCCATTGTACGTTaTAGGTAAGACACTGGTGTACTTCGGCAA
AGATGT