Description :
From Genome Similarity Track
Location :
Scaffold_186:49784- 51320
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_15007Monovalent Cation:Proton Antiporter-1 (CPA1) Family

Sequence
1536 bases(100 bases per row)
AGGGTTTCTTCACCAACTTTTCGACCATCTTGCTGCTCGCGATCGTCGGCACGCTTGTGGCGACGTTCATCACGGGCGGGCTCTTGATCTGGCTCGGGCA
GCTCGGGCTCATCACGGCGCTGACGCCGGCCGAGGCGTACCTCTACGGGTCGCTCATCTCGGCCGTCGACCCCGTCGCGACGCTCTCGGTCTTCAAGAAG
AACGACGCACCGCCCATGCTCTTCAACCTCGTCTTTGGCGAAAGCGTCCTCAACGACGGTGTCGGTACGATTTTCTGCAATTTTCTGCAATTTTTCTCGG
ATGTACACGAGTGTGTTGGCGTAGCGATTGTGGTGTTTACACTCTTTCAAGAGTTTATTCGCCATGGCATCAGCGACGTCGACCATCACGCAGCGTTCAT
GGTCGTACTCAAGGTCATCGCCATCGGCATTGGCTCGGTCGCGCTCGCGGCCGCCGTGTGCTTTATCTCGGCATTTATGCTCAAGGTAGTCGTCGCATCC
CTCTTTTTATTCTTTACGACATGTGCGGATCTAGATTGCCGACCCGATGCTGCAGCAGTACCCGCACTATGAGATCTCGATCGTGCTTCTCTCGGCCTAC
ATTAGGTATTATGCGTGTGTCCTGACGACTGAATCATCTCAACGGTGTCGCTAGCTACGTGGTCGGCGACCTCGCGGGTCTCTCTGGCATCGTCGCGCTC
TTCTTCTCCGGCGTCCTCATGAGCCATTACCACTTGACCAACATGTCGCAGGAGAGTGCGACCGCGCTCAAGCATCTCTTGTCGACGCTCGCGTTTCTGG
CCGAGAACTTTATCTTTCTGTACCTCGGCGTCTCGGTCGTGGCCTGTACGACGACTCTCCTGCGCCCTCCCGTACGACGACTCTCTTTTTTTGGTGCTAT
TAGACTCGTCGTCGTTCAAGTGGGACTGGCGCTTTCTCATTCTGCAGCTGCTCGTGCTGCTTTTGGCGCGTGCCGCCAACACGTTCCCGCTCTGTGCCCT
CGCCAACCTCGGCCGGAAGGACGCGATTCCGTTTTCGGTATCGATGCTGAATTGGACGTGTAAAAGGAGCTCTTGTTGATGTAGCACATGGTGGTGATTT
GGTTTTCGGGCCTCCGCGGTGCAATTGCCTTTGCCCTCGCGCTCAACGTCTATACGCCCGACGAGTCGCACGCCGGCGTCATCAAGAGCAGCACGCTCTT
CACTGTCATGTTTACGACGCTCGTACGAGCTGCTCGAGCTCTTGACGCGCGTCTCATGCTCGCTGTAGGTCTTTGGCGTCTCGACCGGCCCGCTCCTGAC
GTACGTCGGGCTCGGAAAGCGCAATGCGTCGTCGCCGTATCTGTACAGACTGCCATGGATGATGGCATCGTGCGAGGACGATGGACGATGATGGCTGCCT
TAGGCGTCCCGAAGCGGTCAAGCTCCTCGACGAAGTGCACGAGTGCGGCGGCGACCCGATCTCGCCGACGGCCGAGACGGGCATGCATGGCATCTGGAAC
GACGTGGACGCCAAGTACCTCATGCCCGTCTTTGGC