Description :
From Genome Similarity Track
Location :
Scaffold_166:49778- 50801
Transcript NameFunction/comments
g6501.t1hypothetical protein

Sequence
1023 bases(100 bases per row)
CATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACA
CGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCA
TCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACA
AACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGGTCGAGATTCAAG
GCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAATATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGTGACTTCGT
GTGAATGCATATTTTACGAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGTACGCCTGTGG
TTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGG
TTCGTACACACGGGAACCACGTGAAACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGT
GCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGG
TTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGG
TTGTGGTACAAGTCAATAATAAA