Description :
From Genome Similarity Track
Location :
Scaffold_43:49772- 53856
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.43Possible MAPK
Pytap_DAOMBR444maker-pag1_scaffold_43-fgenesh-gene-0.103-hydroxy-3-methylglutaryl-coenzyme A reductase
Pytap_DAOMBR444maker-pag1_scaffold_43-fgenesh-gene-0.21Phosphopantethiene--protein transferase domain containing protein

Sequence
4084 bases(100 bases per row)
AGCTCATCAAGTTCATCACTGGTGTTGACACACTTCCTCAGACaGGGACAGAGGTGCGTTGTGCTCTTGATGTCGTCCATATCGTTCACTATATCTCATG
AACGGGGAcGCTTGTAGTTCTTGCGAATCGAGATGCCGTTCCCATCGCTCGCGGCCAATGACCACGACAAGGCGTTGCGCATGCTCCCGCAGTCACATGT
AAGTCCCTTGAAATGGCGTGAAGACGAACTCATGAGCTCATAGACTGTGATCCTTCCAGACATGTGACAACActCTCGAACTGCCCAACTACTGGCGAGC
GCTGTGCTGGAAGCACGCTCgCGACACGGAGCAAGAGAACGCAGTCATTAGGTCGGAGCTCGTAGCACTACTGAGCGAGAAGCTGCGGCTCGCAACCGAG
TATTCATCCGGGTAcGGACTGGACGCGACGCAAGCGGCGTCGAGCAGCGCGGATTTGACCGCAATTCTTTCTCACCACGCCAGGGAAGGCGATGATaGAG
AAGAAGAGAGCTACGAGTCGCTAGATGTGCCTGCGCTGGGTGAGGgAAGCGTCGAGGATCGATGCCGAGAGAGCGAGAGCGAGCAGAGAGCGTCTGAGTT
GGGACGACGCACTGAGGCAGAGGATGAGCAACCGACACCAACGCCAGCGTCCGACACAGACGCAGTCATTCGGAGGGACGAAGACGAGTCCATGGAGTAC
GGAGCCGACGACTTTGAAGAGGAAGAGCTGTCGTGAGGGGAACGCGAGCGCCACGTTGTAGCCATTGGCCATCATCACCATGACCAAGGCGGAAGGGGCA
CGGGACGAGACCCATCTCTTTCGCGAAAGCGCGGTAGGATTGTCGAAGCGTTTCAATAACACGGTAGACTGGTCGTCCCAACGGCCGCGCGCCACCTGGT
GCCAACATGACGTGGCACCGTGTATTGGCAAATCGAGTCCCCGTATTTTCAGCCACACCCGAcctacactCCCGGTCAGTCAACCACCGCCCAGACGTCA
CGTGGGCGTCACCGTCGCAGTTCCTCCGCCTCTCGTGACAGACGACGCGGTCTTCCTGCGGCTtCCTGTGCCCGCCTGCGTGTCCACGCCACTTCCCGAC
GCGCCTCGCAAGACGTTCATGGCCTAGGACGCGCGCCATGATCGACGTCCAGAGCCCCGCGGCGCTTGTGTGCGCCAACGACTTCAACGAGTCGCTCGAC
CGCGTGCTGCTCGCGAGCCACGCACTGCTCGACGCAGCCACGCGCCTGAAGACGCTGCCGCAGGACGGTAGTGTCgTGAAGaaGCTCCAGGAGCTGTGCA
aCACGACGACCAAGCTGCGCGATGTCATCCAGCAGCGCCCAGCGgTGGACGAAGCCGCTGCCGTCGTGACCAAGCGCTTtGATCCGCTGCAGCCCACGCC
GCCGGCGACGCTTGACGAcGGATGGGGTGCTGCCAATTCAAGCCAATCGCAGCCATCAGTCTGGTCGGgCTTCTACAACAAGACCCTGCGCGAGCGCTTC
GATGTGCTCTCGCTCATGTACCCAcGCCTGCAGCGCGTGGTCAAGCATGATGCGGACGAGGCGTTCGCCATGGACAAGCAGCCGATTCTCGACGCCATCA
AGCTCGGGGAACTGCCTGTGCGGACGGCGAACCTCATGATTGAGAACTGCATTGGCGTGCTGGGCATTCCGCTCGGTCTGGGGCTCAATTTCCTCATCGA
TGGCAAGCATCTCTCGGTGCCCATGGCCGTGGAAGAGCCATCGGTGGTCGCGGCAGCATCAAGCGCCGCCAAGCTCGTGGCCTCATTTGGTGGCGGCTTC
ACCACGGCCACGACGGGCAACATCATGACCTCGCAAGTACAGCTCGTCGACACCCCCGACATTCCGACGGCGATCGCCGCCATCGAGGCCAACAAGGATC
GACTGCTGCACATTGCCAATACGACACTGTGTCCCAACATGAAGAAACGCGGAGGTGGGGCCATCGACGTGTACTGCCGCGTTGTCACGCAACGCTCTCG
ATCGGACCATACGCACTCGACCAGTGGAGACTACTGGTATGCCAAGTGTGACGACGAACTGGTCGTCAACGCGTCCGACGCCGACGTCGAGTACTTGGTC
GTGCACATTGACGTTGATGTGTGCGAGGCCATGGGCGCCAACATCGTCAACACGGTGGCCGAAGGCCTGACGAATGAGATTTGCCAGCTGACCAAGAGCC
GATGCGGCCTCCGTATCCTCACGAACCTCTGCATGCAACGTCGAGCACGATCAACATTCGAGATCCCAGTACAGAAACTCGGATGGAAGGGAGTGGAGGG
CGAACAGGTCGCTCAGCGCATTGTCGAAGCATACAACTTTGCAGCCATCGACCCATACCGTGCAGTCACCAACAACAAGGGCATCATGAATGGTGTGGAT
GCCGTGGCACTGGCGACTGGGCAAGATTGGCGTGCCATCGAGGCGGCTGCTCACTGCTACGCGAGTCGTTCGGGCCAGTACGCATCGCTTTCCAAGTACG
AGATCGTCGAGCGGGACGACGGCAAACGCGTGTTGCGAGGCAGCTTGGAGCTTCCTATCTCCGTGGGCTCCAAGGGCGGTGCCCTTCAGACGCATCCGGG
CTACCGCGCTACTCACTCCATCCTGGGTCAGCCCGATGCTCGCAACCTGAGCAGCATCATCGTGAGCGTTGGCTTAGCTCAGAACTTTGCGGCCATTCGT
GCCATTGCAGTCACAGGAATTCAGAAAGGTCACATGGCATTGCACGCCCGCAACATCGCTGTCGCTGCTGGGGCTCCAAGCGAGCTTGTGTCAGAGGTTT
GCACGTACATGCTCGGTCGCAAATGTATCAACGTTGAGACGGCCAAGGAATACCTGCACGCCCACGAGGTGTTCTCGGAGATTCACAGCAGTTCCCCACC
ACTGTCACCGCAGCATCAGGTGCGAGAGTCACCACTGCCGTCGATGTTTTATGTCGAGATCCCTGTGCCTCATCTCGAAGGAGCTGTGAGTCTCAATATT
GCATTTGAGTCGATCAACAAGCACCCGCAGTACATTGCGATCCAGCCCACAGGCCGTGATGGCGACAAGAAGGAGCTGTCGGTCATCCAGCGTCAGCtCC
TTGGCGACAAGGGCTACAACCAGCTCGAAAAAATGTTCATGTTCCTGGCCTCGATGCGGTCAATTGTGATCTCGGAGATGAGAGAGGAACGATCGAcTtC
GAATGAGGACGAGAGCCCCATCGTGATGCTGTCTCGTGCTAATTTAGCGCTTCAGAACAAGCTACAacTGCTCTCAGTGCTCATCAACATCCTCGTGTAC
GTTTGATGGAGGTGCGCTCAGCTGCGGCCGGTGCGTTCATGCgTGAAGTGCTTGCCAGTGGCtcGTCCCTCAGCGATCTCGATGCGACACGCTGTCGTCT
GCTGCTGAGCGACGTTCCACCAAGTGACGATGTGCTCTCGACCGGTCTCCCGCTCTTCCTGGCTTTGTGTCAAGTTCTCAGCTATCATCTGGACCAGGAT
gTATCTCaCAAACTCGtGCGCGAGCGAATGGCGACAGAGCAgTGGACGcTACTACGAGCAGTGGtGCACAGCTTCGAGCTCGTCAGTGGGCCAGTCAGTG
AGGCAACAGACCCTGACGACAAACTGCTAGCGTTCATGGCTATTCACGCCAAGCGCTGGCAAGCGACGATGCTGCTCCTCGTGGACACACTGGCAcTCCC
ATCGGAGATGGTTACGCCCTCGCGCCTCGATGCCCTGTCCGCAATCGGTGAGTACATGGAGTGGGAAGGCACCGTCGCCCACGACATCGCACGATACACC
AGAGCTGTGGCCGAGCGGATCCCCAATGCCTTTGTGTATTGGTTGCGCCTTCACGGATACGACTGCGAAGCAGACAACGACTCTGGCAACCGTGTGGACG
CCTTCCGTCGTGTTGCGGACGTGTCGGCGCAGAGCAAGTGGCGTGTCGTGGAGCAGAAGCTGGCGGCCGACGTGGAAGCGAGAAGCGTGTTCTCTCTGTC
GGCGGTGACTCGGGTGACGCAGATGGTGCGCGACGTGTATGGAGAACGCAgCGGGCGACGACCACGCGAAGActCGTTCTAGAG