Description :
From Genome Similarity Track
Location :
scaffold_459:4977- 6111
Transcript NameFunction/comments
g8546.t1hypothetical protein

Sequence
1134 bases(100 bases per row)
TCTCGTTCGACGAAGGTAGGATTGCCAGCAGACACCACTACAATCCCGTGCGCGTGTACATGGAAAACAAGCCTATGAAACGGGGAAACAGTGTGCTGTG
ATGATGCAGCATACAGCCCTCGGTAAGTTCTTCTTCTCCTGCATACGGCAGTATTGCTCATCAGCTTCACTAACGATGTGATATATGCTGTATGATACAG
CATAGAAATTTATCGCGGAAAGGAGAAAACAACGAACGCGATATCCAAGGCAGTCATCCCAAACTTGATGAAAGCACTAAAGGGGCAGCCTGGTAAGCGA
CGGATAGTGACCGATAACCTCTACACGCGCGTGAAGTTGTCCGAGCCCCTGCTGAGAATGGGTTACTACAAGGTGGGCACTTCATGCATCGACAGAAAGG
AGTGGGACAAATCAATTGAACTGAAAAAAGAAAAGAGCCAAGCGTGACACTAGCTGATTGCAGTACCTAGGAAGGACTCGAGCATCGTTAATTTCCTTGC
CACTGGCGTCAGCACCAAGCCAGACCAGGTACAGCGCAAGCGGAAGTCTGATGGCGTAGTGGAGGCAGTGGCATGCCCAGCACATGCTCGCGCGAACAAT
GAAGGGATGGGGGAGATTACGAGCATGACCAGCAGAGGCTGCACAGGTATTCACTGCAGAAAGCTCTTCGCCACCGCTCCTACTACAAAATCTTGCTCAT
AGGCATTGTGTATATGCCATTAGTGAATGGATACATCGTACACAAGTTAGTGATGAAAGAGCAGGGCAAAAAGGCACCTACTCATGGGACTATATGGATC
GCCTCCACCGTGACCTTCTCGGGCAACAGAAGAAAAACTTCGAGAGGGATATGCAGGGGCCGAGTTTGCTGACCCGACCAGTAGCAAAGGCTCCGCACGT
GCTGACCGAGGAGAAGGCAAAACATGACGACTCCAAGACCCGCCAGTACCTCTGTAATGTTTGACCAGCATACTCGAACAAAGAGCATCGAAGTGCAGAG
TCCCGGTTCTATTGCAAGCAGTGCTCCACAGTTTTTAAGGGCAGGGTCCAGCTATGCAATACCATTCACCGTCCCAAGGAGGAGAACACCCTGACTTGTT
GGCAGATCTGGCATGACACTTGGAAGGACGGCAC