Description :
From Genome Similarity Track
Location :
Scaffold_15:49758- 51017
Transcript NameFunction/comments
g3080.t1POM76328.1 Hypothetical protein PHPALM_6441 [Phytophthora palmivora var. palmivora

Sequence
1259 bases(100 bases per row)
AGCGTTCGGACAGTTTTGATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTC
GGAAGCCGCTGCAGTATCTACAGGACGCAGCAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGT
GGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGC
CGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAGCTCATGAAGGTGAAGAGCAATTGGATGCGATCCTTCGCTC
CAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGTTAACTGTGCCCGTGGAGGCGTGGAACACTCGGCAGGTGGCCGAGGACACGGTGCA
ACTCCTACGCGCAATGGGATGTGAACCCCAAGTGTTCCCGTCGGAAGCAGACCTCCGAGCATGGACACCCGAGGACGCCGCTACGGCGCTCCGCAAGTGG
AAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTC
CGTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAATATTTTCAGCCCAAGGTGCGACGTCGACATACTTCCAAGACTCTCACAT
GGTGACGCCGAGGTCGGTCAGTCGCACAGAACGACTGGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGTGCAAGTCGGACGCCC
AGCCGACGTTACGACCTCCGCGATGACTCATCTGACGAAGATTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTC
GTGAGCTGAGCGCTGTGGCGAATGACAGTGCGACACCGAGGCTAGAGATCGCCACGCATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGA
TAAGAGCGAGAAGTCCATGCAGTGGCTCAGAGCGTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAGTTGAGC
CTCCAAGATGGTGCTCTGCATTGGTACCGACAGTTGCCCCGCAAAACGAGGCGCACGTG