Description :
From Genome Similarity Track
Location :
Scaffold_18:497506- 505542
Transcript NameFunction/comments
Phyin_T30-4PITG_10283Putative uncharacterized protein
Phyin_T30-4PITG_10284Cellulose binding elicitor lectin (CBEL)%2C putative

Sequence
8036 bases(100 bases per row)
AGCTCATCGATAGATTGAGAGGGAAAATGATTTCCCATAGCAATTGCAGCCTTCATCACTTGATCACAATGATCCGTAACTTCAGTGTTGCTGCGTATGT
CTCTCCACAATGCACTTAGGAAATGGCGCATGGAATCTACGAGTGGGAACTTGGAGATGACGCAAAGGCCACTTGGTAAGTCTTGAGTGCCCAGCGCACT
GCTTTGCTCTGCTGGCAGCCACATGACTGCACCGTGGACAGCACTAGAGCCACTTCCAGCGATGAAGTTGAATGCCAATGACCTTGAAGCTTCAGGGTGG
GCGTTCGATGGATTCAAGAATGGCTGGATCGTTTGAAAAGAAACTTGCTGTGCCGTTGCGTTACTTGTATGAGGTGAGATATCTGTGAGCTTGATGGAGT
TGTCGGGTAGAGCCGTGATAACGAATACTTGACACTCAGCTCGAGCGAACAAAGTGACGGGATCTTCATCGTGCTGTGCTCTCAGCAGCTCTAAACTATG
AGGATTCGCTGCTTTAGGCTGCTGATAGAATGGGATTCGAGCAGCACGAAGCAAAGTCTCTATGTTCCCGGGGCCAGATCTGTTAGCAAAAAAGTTGCGA
TAGACGACACTGTCCGCAAAATTGACGTAACTTTTGGTACCAAGCACACGGAACTCTCGCTCAACTTCTCGAGCCAACTGGAGAAGTGCTGAGATTGCCT
TCTCGACATGAGTACCAGCTGTCATCTCGCTGTTTAATACTTTTTGGTCGAGTAGAGTTTGTATCGCAATGGAGAGTTGAGCCTTGGCGCGACTTGCAGC
AGGTGACGCCACAGGAACGCCATTATTTACTCCATTCAGGGAGACGAAGCGGGGGTGCAGTCGTTTTAGACGAGCCACTAGTTTCTTGAAATCCATCTCT
TTATCTGTAGATTCGTTGGCTACTACATGTAGGTTTTGGTAGAGTGGCGTTATTCGAAAGGTAGTCTCAATCAAAAAGCTCAGGCGTTGATGATGCTGCT
GGTGCCGACCAACAGACGAGCTGTACAGATGAGTCCACAACACCAAGCAGCTCCATTCATCTGACAACACCTCGTCCAATGAAAAGCGTGTTTCTGGTAG
AGGTACCTGGCTTAGTGACGCAGCAGAATGGGCTTTCGAGATTGACCCATTCGACGCTACGATGGCATTTGTCCTGGGTGGTAGGTCGGTCGTAGCAGCT
CGCTGACGACCGCTTTCTGGCGAGGTGAAGGCTTCAAAGTTGCCTTTTGAATCGTTGGTAATTGCAGCTGCGCGTAGCTGGTTTACTGTGGCGTGAGGGG
AAGATGGGGTAGATGTGGTGGCTGCGGCTACTTTCTCGAAAAAGTTATCGAACAGGGAATTGGATTCAATATTTGGTACAGATCGTCGTCGGCCGACAGC
AACATGTGTCTTTGTTGCATCGATCGGTGAACGAGGACTCGGTGGAGTGCACAATTCACTGTCGACAACAAAGTGGGATTCATCGGAAGTAGTAAGGTGT
TTCTGGTCACTTGTCGCGCTGGGCTCCCCCATTTCGCCATGAAGCCAGCTGACGAGTCCTCCTTTCTGTTGAAAGGCGGAGAGAGCACGTTTATGCTGTC
GAGCCACCTGATGCGTCTTGCCTTTCAGTGAGGCAGCCGCAGCACTTAGAGCGGACAATGTACTGTTTGAGTTCCTCGTTGGAATTGTGTTTCGAGGCGA
GCTAGAATGCCAACTCCCACTTCGCGTAGGTGGCCCAATTGTTACCGACGTAGAAGATTGGTGCGGGGTGATAGTCGCGGCGTCATTTCCGTGCCTTGGC
ACTTCATTCCGCTGTTGCAGTTCGAGCTCAAGCTTCGATGAAGATATCGTCACTGACCGGAAGTCATCGGTGACGCTTCCCAAATTTTGCAGCGGTTGAA
CTGAAGCTTCCGAGAAGGATTGCAGGGTGGATGCGCTCCATGTTTTTTCCACAGAGGGCACGTCAGCACACGTTGCGTCTGCCATTGAGCCTTGTTTCGT
GAGTGCAGTGCGCTAAACCGTTCAAAAGCCGCGACCGTTATGCACATGTTTCTATTCCAAACAACCCTACTGTCGCCCTAAAAATAACTGGCAGATCGCT
TTCCATAACTTTGCGGAGTTTAGGATACTTGCACAACATTTTTCTGTTGAAGTGACCACCAACAGATGCACATTTGAAAAAAAAACTTCTATTAAGATTA
CCGGTACAAGCTTTCATGAATGCAGTATATTTTTTTTCATGAAACAATTTATACCCACAACACCGGATTCAAGCACGTAGCATCCGTCACACTGTCTACA
TTTCTGTAGCAAGTCGCATTTGCATTGAACCCACCAGCCTCACGTCCGTTGCATACATGAACCTGTTCGTGGCCACCAAGCGCTCATTTCTCGATTTTCC
TCTTCGAGCACAAATCCAAGTGAAGGACCTGCATTCAAGACCATGCAAGTCACGACCGTGCTCTCACTATTGGCGGCGTGGACGACCATTTCGTCGGCAC
AGTCTCACATCCGTTGCCAGAACACTATTGGTGGCCCTTGCGGTGACAGTTCTCGCCCTCGCGAGATGAACTGCTGCGACTATGGCTATTGCCAGCCGTG
GAACTCAGGCTACTACCAATGCATCGACAAGCCCGAGCTCTGTCCGAACCAAGAGACTGACATTGATTACAACGGGAGCGATCTGCAGACCATCTACGGA
ATCCAGCCGGACGCTTGCTGTGCCAAATGCGCTGATACCAGCGGCTGTGCCGCGTATACTTTCGTGAACCAAAATTCCGACGGCAGGACGGCGTGTTACC
TCAAGACGTCGACATCCGGTCGTGTCGAAAAGAAGGGAGCGGTGTCTGCCGCTTACAAGGATTTCAACGCGAGTTGCCAAGCGAAACTCTGGCATAGTTG
TGGCAACTCGAATGGAGTCACTTGCTGTCCGGACAATGCGTACTGCCAGCCGTGGGACTCTAAATACTACCAATGTATCGGTCGTCCGGACAAATGCCCT
GATCAAGAGGTTGACGTCGACTTCTACGGCAACGATCTCCAGACTATCTACGGGTTATACCCGACTGATTGCTGTGAGAGATGTACCAAAACTAGTGGCT
GCGCTGCCTACACCTTCATCAATGAGAACGCTGATGGTAGGACGGCGTGTTACCTCAAGTCATCGACGGCTGGACGTAGAGCGAAGAAGGGAGCTGTCTC
CGCTGCGTACAAGGACTTCACGGAGCCTACGTGTCCTGCGAAGATCGGAGACTCGTGTGGCAACTCCAATAGTGGCCCTACCTGCTGCCCGAGCGGATCC
TTCTGTCAGCCGTGGAACGCAGGCTACTACCAGTGTGTTGCAGCGCCGGAATGGTGCCCAGACGTCCAGGTGGGAGTGGATTACTACGGTGACGACCTGA
GCATGAAGAAAGGTTTGCAGCCTGATTTGTGCTGTCAGGCGTGTCTGGACGACGCGAAGTGCAAGGCCCTCACTTTTGTGAGCAAGAACGACGATGGTCA
GAGCGCGTGCTACCTCAAAACTGGCTTTGGCACCCGTAAGAGCCACCCAGGAGCGATATCTGCTTACAAAATCGAAGCGGTTGAGTAACCAAGGGGCTAA
CACTCGAGAAACTTGATAGGCAGCTTTCAAGTAGCTTCCAGTACAGAACAACCATGAGTTTTCAGTAAACAGAAATTTACATGCTGGTCACACTCTGTTC
TTTTGGGACTTAAAGATTTATAAGATGTTTTTTTTTTCATTTCGGACGGGATGAAAAAATCTTTTCCCGGCAGTTGGTACTTCGAAGTAACTTTTTTTTC
GGTAAAACTTCAAATCTGATAAGGAAAAACAAAAAGGCAGAATGTAAAATTCCCGAGACCAGGTTTGATTCTAGCATTATCAAAATAACTAGGGCTCAGA
TAGTTATGCCGAACTACTGTAGATCTCCCAGAGAAACTGAGATTGAGCGACTTCAGCAATGGTCCGCGTGAGCAAGGAGGTAATACTACAGTTTCTAGCA
GCATTGTAGCAGTGCTTGCTGACCCCTGACCTGGCCTGACCCGTATCCGACCCAAAATTATCTAGATTAGCTTAAATCAAATAGGACTTTGTTTTGACAA
AAACAATATTAAAAAAAAGAAAAAATACTCGAATATTAAACTTTAATTATTGCAAGCACCTTCCTTACAGTTTTTTGCAATCCAGTCAAACCTAAAAGAC
AAGTCCGCGCCTACATTTTGTAGCCCCCGCTAAGACACAGTTATTGAGGGGGGGGGGGAATCGTTAACGAAACGTACCAAAATGCGTAACTCGAAAAGTA
AGCGTGAACATCATCCATAGGATCAGTTTCGACAACACGAATGGCATTTGGGTTCGCAATACAAAAGCCAGCTGATAATACGCGTCGATGCCACAATTAC
GCTTCATGACGAACGCCAGAGCGATAAAGGAGAGAAGCTCAAGTGCTGCGTAGATGAGCACACTTGACACCGTGTTCGCGACATTTTCACGAGTCACGCT
AGCCATTTCTGTGTGGTATTGTGCACCAGGCAAGTGTGTCATGGCAAACAAAAATGTGCCATAAAGTACAGGAACAACGATTTCCAGATACTCGGTTAGA
ATGAGACATTCAGCTGTAAAAAGAACTTCGAGAGCCTCCTGGAGAGCATCAGAGCCGTCGACGATCCATGAGTTTAGCTCACTTGATTCCTTATCTCCGT
TAACAAGATCATCTCCTTGTGTCTTCTTTGGGGCGACTGATACTGTAGGATGAGGATGAACAGCAACAGCACTTCGACCGTGATCAGGGATCGCGACCAA
TCGCTGAGGTGACGTAGAGATTCTATTCAGCGAATGATGAACAAGATTTGTAGGCGGACAGGCAGCCGAACACCTCTCCAGTTGCGCCAATACAGTCCTT
TCCTGGTGTGATAGTTGATGGGGAATACACGATCGCACTTGAATTTCTTGGTTTTGAAGTATCTTCGAGTTGAAACAAATCAATCGAGCAAAAGCTAGTA
GACTGAAGCTATCAACATTATCGCGAATACGAGCAGCCCTGTGAAGACGCGCTGGAATGTGTTGTGTGCGGTGAAAGAGCTCGAATAGATCGATCGCTGT
CTGAGCGATATCGACAGCCAATATGATCCCAAATGACACAGCAGACAGACTCGGCATGCATGTAACTAAGTACAACGCATCGAAAAAATCGACCGTAAAT
ATTACTTGTTCAGGAACCATATCCCATTTTTTTAAAGCTGCAAGCGCAAACAACCGCTTCGTGATGATCTTGAAAATTGGGAGTAGCAAAAGCACTGGAA
CTTCGTAGACAGTATGGTTTACTTTGTTGAAGAGAATCTGAAAAGCTGGGTACCCAAGGATCATAATTCCCAGCAGGTTCGACACATAATACAATTGACG
CAGTTCGTCACGCTTTGAAAGTATTCGCCGAAATGCGCGAGTGCCCACCACAGCACAAAGAAGCAGCAGGAACAGCCAGGACATTGAAATTAACAGAGAA
AGAAGAAAGAAAGGCACAGGGAAAACCCACAGCTCTGAAGTTGCCATGCCCACTACGAGTAACGCGGTTGACACACAGACGCAATACACCAGCTTTTGCC
TCGAAGAAAGCGCTGGTACGTCAAGCCACGGCCCTACAAGATCTGCCTTAACTGAGCCCAATACGAAGCCAATTATCCACACACGAGGCCAAAATCCGTA
ATTTGCCTTCCACCCGGTCGTTGGATCCTGCAGTGGAATGCTTTCTTGGCATATTACAATGGAGATTGTGATCAGGGGAGGCGTCAGGATCAGCAAAGCG
ACACGAATTAGTGACGTTGTACGGGCGAACTCTGAGAGCGCCAATGTCCGCTCGATAAAGTATTTGCCACCATAGTGAGTGAGCTGCAAGGCCTGCCATG
CGCGGAGAATTTTGCTCCAGAAATCGTCGAGAACCATTCGTTGTTTCCACCAAGACGTAGCGTCTGCGCCTTAGCTAATCTTGAATCCTGTAACAAAATA
ACGAAGGTCACCGATAGCGAAGTACGTGGCCTCTCGTTTGCTACTTACTGCACCTGCTACTTGGTTGAATTCCTCTTTTTCACAACTATTTTTAAAGATC
CTCCTTCGAAGTGAATGTTGCAAAAGCTACCCCTTATGATAATGGAAACCGGTTACCTCATAGTAATTCTTGTTTTGACAAAATTGTTAGCCGAATGTGC
AGTATTCGAAATACGTTTGGATGTTCCAGTTGGCGATTTCCACAACTATGCTCAAGCGCCATCTCTCAATGGCACCGCGCCTTCCCACACTCAAGCTCAG
GTCTGCGTCCGTGTTGTTTGTCGCAATGGCTCTGAAATTCTCCGCTTGCCGCATGTCGTAGCCATCCTCCACGCGTTTCTGGACTGCTCTCGTGAAATCT
CGCTGCCCAGCGCTTGTAGTGCCAATTTCATGCATTTGCTATGTCGGAAGCTCTCCGCACTTGCCAATGAGAGTGCCAATAGCAAAATTTTGCTTCCAAA
GTTTCAAGAATACCAGTTTTCAGCTGCAATGGCGAATGCTATCAGTTTGGGGAATCTAAAAATGGTGCAGCTATTGTCGGCATACTTTAAGGGTTTCGTG
TCTACACGAGCTCTGGATGAATTGATCAATCGGAAATTGTCCACTGGTTATGGATTACTATCTTCGCATGAGGTTGACCGATGGTGTCGTTTGGCGTTGC
AGTCGCTATTAATAATAACCATTTTGAGCTGGCCAAGTGGCTTGTGACACGGGTGGGGGAAGACGAAGCATATGTGCTTTGGCAATTGCTGCGAAGAATG
GAAACCTGGAAATACTCCAGTGGGTGTGCACTTTTATCGAAAAATGTAGATCTTAAGGAAGCTTGGAAAGCTGCGATGAAAACCTGCCACTTGCAGCTGG
TCAAGTGGATTTTGCAGCAGCCCGGCGTCATATCGCGCGATTTAGATTTCTTGCTTGACAGTGCGTATTCCAATGGCCACGTTGGCCTTCTTGAATGGGT
CATTTAACGTTATTTTTAAGGGTATCGAACGCTGATGTTCAAGCTGCTGCTGATGGATGCTTGGATATCGTGCGTCTTCTTCATGAGAACAACGTTGATG
GATGCAGTAGAAACGCAATGCAAGCGGGGGGCATTTGGATATTGTAAAATGGTTGCGTATTTGTAAGCACGTTCCAGAGTTCGGGGAAACGGACACCAAG
GCTATTTCAAATGCAGCTAAGAATGGCTTCTTGGATACTGTCAAATGGCTACGTGACAACACGTCTGAAGGATGCGATACTAATGGACTGCCGGCTTGAC
GTCATAAAATGGCTACACCACAATCGCTCGGAAGGTTGCACTATTATAATATAGTCTTGCAATGGATTATGCGGCTGGTAATGGACATCTGGAAATGCAG
TGGCTAAGTGTTAACAGGAAGGCAGGATGCACTACAAAAGCGATGGATGCGGCAGCTGCCAGCGACTACCTAGACGTTGTAAAGTGGCTTCATTCTGACA
GAACTGAAAGGTGTACGACAAGGGATTTGGACAGTGCTGCAAAAAGTGGACACCTGGAAGTGGTGAGTGCCAATCGATCCGAAGGGCTATGGATCGTGCA
GACGTCTTGACGTCGTAATATGGCTCCACAACAACAGAGACGAAGGGTGTACAGTTACTGCGATGAATGCTGTCGCTGGAAGCGGTTACATGGCCGTGGT
CGAGTGGCTGCATACCAATTGAAGCGAAGGCTGCACCACTTGTGCAATGGATGCAATCAATACCGGAATGTGGTCGATTGGCTTGATCAGAATCGGACGG
AAGGTTGTACTGCCGCCACAATGACCGCATTTGCCACTCAAGGCCACATCAAAGGAGTTCGCTGGTGCCTTGAGATCGGTCGACCGTTGAATGCTGTCGC
AATTAAACGTGCTGTGCTAAATGGCCATTTCGAAGTTGCGTGGCTTCTTCATCCATATGGACAGAGGACCCGGTGTAACGTCATTCGAGCTTTAAACGAA
TGCACTTATTGGAATCGCCGATGGGAGCTCGGTGAG