Description :
From Genome Similarity Track
Location :
scaffold_12:49750- 57221
Transcript NameFunction/comments
g750.t1 hypothetical protein PHYSODRAFT_552333
g751.t1 hypothetical protein PHYSODRAFT_471503
g752.t1hypothetical protein

Sequence
7471 bases(100 bases per row)
CTACGCCGTCCCCCAAGACGCTGTACTAGACTATCAACCACCCAAAAGTTCAAGAAGATGCGGCTTTCTTACAACAGGTAATAAACGTCGAGCGTGTATC
ATACTAGTCCAATATTTAGAATATCTGATCGAGGGGAATTTCTTCGGAGAGATGCGAGTCGATGGCGAGTTTGGCGACATATTCCTTGTTGTCGCTGATG
GCTGTGCAAACACCATTAGTTTGTGGCTAACGGGGAATTATTGGAGACTGACGTACCATAGGAATGACAGCCGACGATCCAGTGTGTCTGGTTGTAGCGG
TCTGCGGAGTATTTGGAGCGCTTTATCGGAATGGTTTCTTCCTGTGCGAGACGTCTAAGCAGAGCGCGTTCGTACTTGGCACGCAGATCCGGTCGCAAAA
GTTGGGTACCTCCTATAGCGACTTTTTCCTGTAGACAAACGGTTGGAATGGCTGGAAAATGATGACAAAAGTTAGACAGCCCCGTCCCAAAGGAGAACTG
CGCTGTTACACTTACCGTCGAAGTAGTTGGGGATCCCTTTCGGCACGCGTGGTTTCTCCAGTAACCGAGCGAGGGCCGGGAGGATACTTCGGACCAGAGC
TGGCACGTACTCGAAGAGCAGAGTCCGGATGACCACGATGGCACAGCCAGCGATAAAGAAGGCGAAAAGAACCACAACTTGAGGACGCGTGACGCGGGAG
ATCAACTGGCCGCGGCGAGTTCCGTCAAACAGAGGGATCCCGTCGCCAGGGCTGTACGTGCTGTTCATCGTGGCCTGCTCAAAATCTCTATCATTTTCTG
ACTCAAAGATGCGGTCGTTCGAGAACATCCACAAGGCAATGAGGCAGTGCATCAACACCGCATACGGAAGTAAAGCTCCCGCTGCTGTTGCCAACTTGCT
GTCGTAAAGAGGCGGAGATCGAGCAATCCGAAGAAATGCTGCTCAATTTGCACTTACTTGGTTAGTCGAGAGGCTCGAATAGAAAAAAAAAAACGAATCA
CGTACTGAATTTGTCGGCCCAATACGTCATGATCATCGCCCCAAACCCGATAAAATGAAGCAATGGCATACCTGCCGAGAACTACGTGCGCAAATATTAG
CGAGAGCGTATTTTACGCTTAGAATGACCACTTACCATGTACGTGATGAAAATTGAAGTGAGAGATTGAGCGTAACGTGCAGCGAGATCGAATTTTGGTC
CACGGTAGAGCGCTTCGAGGTCTCGCTGAGTGTCTTGCTTAGTCAAAGAGTGGTCGAAAGAATACCCTCGATCGATAAAGCGGCGGGCCTTGAGCATGAC
GTAGTTTGCCAATACGTAGGCGTGGGTACTGAATGAGTTGATGATCATAGTGAGCATGAGCGCCACACCAACGTCGTTGTACCAGTTCGCCGAAAAGTCC
GAATACTCGCCGTCCAAAATCTGCAACGCTCCTAGTGAAAAGCCTTCGTTGGAGATTCCAGTCACCGGCACAGTAGTTGAAGATGAGAAATAGTTTGCGT
TAGCGTTGATAACCAACATCAGCAGTGCCGTGTTGCAAAATTGAGCGATGAAAACTTTGGTAACGCGGGACACGACCAAACTGGACTCGGTGTGGTGCTT
CTCCAAGGCCACAAGTCCATTGAGAATACGAGCGAGAATCAAGTTCACAGCCACAACCAGCAGAACCGAAGTAATGGACAGGATTTGAGTTGTCACGAAA
GTTGTAGCCCAAGACCTACACAGCAAATCGTTCTCTCCTGTTTCCGGGTTGTCGAAGCTTTCGTACATCATACTTCGGAAAGAACTGTGAAAAAGAAGTT
TTTAGGTTAGATCTCGTATCCTAAAAACAAAATTTCCAATACAAAGGAGAACTTACTGATCGACGAGGAAATTCTTGCAGTAGCATTCGATGAGAGCTTT
GTACGGTACAAGCTGTGAAGCCTTATTGAGTTCATCTTGGACGACATCAGCCTTGAGAACTTGAGTCGGACAACTAGTTGGTCGTCCAAACTGTCTTTCA
AGTTTACTTTTCTGCTCCTTCGCCAGAAAAATCAGTACAAAACTCAAGAACAACACAGCTAGTGTAATCAAGGCCACAATCTGCATAAAAACGCACTTAG
ATAACTGAAAATAATAATGATCAGCGCAGATATCATCGTACCAGTTGTCGACACACCCTCTCAGAGAACGGGTGGTGCAGGTTTTCCCAAATGATATCGG
TTGGGTCCGGAGCCGGACGGAACCGAAGTCTTTTGCCATGGAGGCGCTTGTAGTGGGGCTGAAAGAGACGGTGGAACCAACCCAGATTTGGATATTCCTG
CAAGCAGCGGTGGAAACCCTCCTCTTCCTCGAATGTCACGAAAGCAGTCACAGCTTGCGAAATATTGTACCTCTTGTGACGGACGTGCCACTGCTCCAGC
TTAACGTTGAAGCGATGCAGTGTTACCTCCAATTTGTGGATAGCACGCAGATGACGCCTCTCACGTCTAGCGTACACCTGCTCATCCAATCGTCCATGTA
AGAGTTGCAGCTTTTCATGGCGCTGTTGGGCGATTTCAAGATGACGCACGACTGCACCACGGCGACGGAGTAAGCGTAAGTGACGTGACGCACTCTTGCC
GAATTGGATGTCGGCAACACGAATACGATCAAGCTCCACTGCGAATGGTGGGGCATTACTCAACACAGCTTCTAAGTGTAGACGAATCTAAACATTTGAG
TTAGCAACAAAAAAAACAGAACGAAAACAAACATTTTTAGGATAGCTCACCTCCTGTCGTAGCAAATTGAGGTCATCATGGTGCGGTAAGTGTACGAGTT
GCACCGTGTAGTCGAGAGCCTTGACCTGATTCTGCGTGATGTGGTTTACAGCTTCCTTTTCCTTGCGGCGGAGCCATATAACAACCCCAAAAAACGCGAG
ACTGCAGACAATGTCGCACCCTACTGCGAGTCCCAAGAATTCGCGTCGCTACATCACAAAACGTTAACTGAGAAAACCTAGAAAATTAAAAAAAATGTGA
TCCTTACGCTCATGGAGTCCCAGCCGATGATTTTGAGGCTCCACGCACTCGACAAATCGATACGCGTGGTGAAGCATCGCCCATACACAATCAACGCTCG
GGGCTTGTCTGGTTCACACTTGGAATAGTCACTATCTTCATTGAGTCCAACCTCACAAACCTCCTTTGTGACGTTGGTAACAGTGTCAACTGTGACAATA
GTCGGAGATTTTGAGCAATTCGTGCCGTACTTGACGTCCGGCTCCCATACGTACGTGATCGCCTCACTAACATTGAGCGTACAGCTTTTCTTGCCTAGAC
AAAGTCCTTCGACAATTACTTGCGCATTATTAGAGCCGCAGCCTTCACTTTCTCGAACCCGCATGTCATCAAACATTGGGATCTTTGTGATTCCATTCCG
TGAATAGGAACAACAAGGCTGAAGCGAGACCGGATGAACGCCAAGAAAACACCCTGCTCCATCCAAAGGACAATCAGATCCTTCGGCATCACCACGGCAT
TGGCCAGAACCTTCTGCGACTTTGTTACGTTCCGGACATGAGCAGCTTCCCTGGGAATCGTACGTTGAATACACCGCCTTCACGAAGCCAATCTCACCTG
CCGAGCACGTGAGCGACAGCTCTGCGTTTTCAATAGCTTGATCGCACACACTGCTGGCCTCACTAAGGTGGCCAATACTGGTTATACCCAGGACAGAAGG
GAGTCCTTGCCGCGCAAGAGCAGTGAGTTCTGCCATGGAAGTGCCACCACCAACGATATAAACTGCTAATGTAGGAGCACTGATCACCACAAGCAGGAGG
AAGAGCCACGTTATAACCTTGAGATACTTGAAGTAAAGAGCGATTCCCAGACCATATTGACTCAATACAACCGAATCTGTCGGCAAGTGATGGAAAGAAT
GTGCACCAAAGTCCGTGGAAAACAAAGGATAGCGCTCTGGCATGGCAAAGCCCCGTGCATCCACTCGAGTGCTGGAGTAACGCATTGGATGAGTCATCCC
CCGATCACGCAGGACTTTGGCATAGGAGAGATACTTCAGCTCTTTCGTGCCACAATCCGGAGGGTACCCACCAAGTTGTGCATCGAGACGAGGAGACGTC
ATCATGGCGAACTTCTTCTTGCCGTCCTTAAACCCGCCTTCTTCCAATGCTGTAACATCGACATCTTTCTCCAATCTTTGACAGGGTGGCAAGAGCTCAA
CGTTCTCGATTATAGGCTTTGCATAGCTTAACTCGCTTGTTTTGGTAGACGTTGTGGCTTCACTATGACGTCGTTCTGGTCGGTTGGCAGAACTTTGTAG
ATCCCGCGTCGTCATGGTAGCTCGTCGCCTGCTCTTGGTGCGTTTGTTCACCATGTCATACGATTGTGCAAAGGAAACCGGGAGTATCTAATAGAATGAC
TGTGGTGAGCTCCAACCAAGCACGGAAGTTTCGCTGTCGGCGGTTGCAAAGGAGATAATAATACGAGAAGCATCAGATGGTAGGATACACGAGAAACGGA
CCCGGATTCGACGGGAGTCGAATTCAAAGCACCCCAGTACTCCTGGAGCGATGTACTGAAAAAGGAAATCGAAATATTTGTGCTTAAAATTAACGCCTCG
GCGACTTATTCTTCGTTTTAACCTTGCAAACGTAATTTCTGAATCCATTGCAGTGATCATGCATACAGAACGACAACTTAGTTGGTTTCCCAAACCGTTA
AGAAGAGGGCAGATTGCACGTCTTTCTTTTTGAAGTTGAAAAATACTCATTGGGAGAGAAATAATCTCTTTGCCGAACATTGCAGTGTTGCTCGCATGGC
TAAATGAAACACAGACGGAACGAGTATGCGACCATCCTGCATCTAGAATCCGATGCGATGCAAATGACCGGATCCTCGTACCGGCCTTTTCTTCCAACCT
CGGCTTAGCGATTCATCAAACGCAGCGAGAGACTCGTGTTTTTGTCCATCGATCGCCAAGTCAACAGATCACTAAGTAGACGCTACCTACTCATAAGGCC
AGAAGTTGAAGCAGTAGTTGGTCGTCGTTAAACAAACAGCCGGACGGACTCCTGATCCAGGTCAAGTGCGGTCAAAGATTGTAATTTCACTGCCTAATTC
CTATGGACCATACGTAGGAGCGTGCTGCAAAACCAAAAATTCCCCACTAATGTTTTCTATGCTCGGCATCTCCGTGGAAAGGAAAGACGCTTCCTGTCGC
CAGTAAACTTGGGGGAGTATAGAGTAGAGAACAGCTTCATCACGTTCATGACAGCCTCCTGAGTCGCTGATTTGAGTCAATGATAGTTTCGGTCAAGCAT
CGAGATAGTTTGGCTTTGAATTGAGACTTTTCATCCAACGTGAACCCAGCTCTTTTTGGATACAACTGCAACTTCAGTTGTTCTCCAGCAAACGATGAAA
TCTAGTCACCATTACTTAGCTGGGGCTTGTGGTCATCCATTGCAGTAAGCAAGAGAAATGCTGAAGATCGTCGTTTGTATGTCTGAAGTTGAAGTGATAT
TACACTTACGTTTTGTATGCATGATGTTGAAGTTTTGATCTTCCTGCACAAATATCCTTCTCGAAGCTTTCTGATTATACATGGATGCAAGCTCGCTTCT
GGTCTTCCTGGCAGTTTTGGTTTGCATCAGTGGTGAAACAGTTACTGATATTGTGTCAAAAGTTTGCAAAGCTTTGCCGACGATTGACTACGTCAGAACG
CGACTAGTAATCTGGGTTGTACGAATGGAGTTGAAGTGAGTTTTCAGTCCTGATGGCCACTCATGTTGTGGTGACAAACAAGTCCGTCGCGTGCTGTAAT
GGGTATCAGGTCGGTTCTCGCCCAGGATCATTAGTTCCTACGCTGCGGTGGTCATGGTTGTTGCATGTTACCACAAGCGGAATACGTACGTTCGAGGGCA
ACCAACTCGAGCTCACAACCTCACAATGCCTAAGAATCATGCAGTGTTTCCAAGTTAAAAGCTCCAATACGTTGTAGCCATCCTAGAGCGGTGTCGCCAC
TTGATGCTCGACGAAGATCATTGTCGCCGACATGACGACGTGCGACCACATCATGCCGGCTTCCTCTTGCAACTACACCTGACCTACCTGATCACTATCC
CAAATGTGGACGAGTGCGTTAGTTACTAGGCAACCCCAAGATGTTACAGTCCGCTGGACGAATCGTAAGACAAGCTGATCTGGCATGTGTAGCGGCTGTT
GAGTTCAGGAAAGTGGAGCTCAACTTGTCCGAGATCACCAAGGTGACAGCGACCGACTATAGCTTCAACGTTCTCGCCGTATTTCCACCATAGCCACCCA
TGAGTCAGCGCGCAACTTGGAGCTCCATCAATTAAGTGCGAGGAAAGGCTCGGCGAACTTGCCACGCTGGCGCCAGTATAGACACTTGAGGTTGCAACAC
ACGTCGTCGCAAGTCGCTTGGCCGCACATGGAGACCGTCGCACCACAGTCATTGGCAACCCACTGATTCCTGTCAAAGATATCTCCCAGATCCGGGCTTA
TTCTCGAAAATCTCGACCGCTCGGGGCACCGAGATCGTCTGCAGTCCAGTTTTCGTCGCTCTCTCACAGCATCAGTCACAGACGAGTCTCGACCATTGCA
CAAGCCAGGAGAAAAGCGGGGAGTTTGCTTGCATGTCCCCCAAACGTTCGCTACACAATCGTGGAGGCACCGTATTGCTTCAGTCGTGAAGACTTCGCTG
AAGGTGGTAGCGGAACTGATTCGCACTACAAAAATCAGGAACGACAAAACGGTTGAGGTCCTGGGGTTACGTGTTGGCCAAAGGATGGCACCGACGATGG
TGTCATTGGCACCTTTATACATGTAGTGCCTATCGTAGTTGGCTATCCGAGCTCGAATCAGCGCCACATATCCCAGACCCATGACGATCTGGCAGCATTG
AGCTCTAGACCTTCTCATGTCGGTCCGGAGCAGCTCGCAAGCCCGCGAAGGCGAGACTGAATACTCCGACCATAAATCAGCACCAACGTCTCCTCTCCAC
CAAAAAGCGACATTCCTCTTTCGTTAAGTTGACAGTATCAGGTGTCTCCTCGCCCTAAAGTCGACACAGATCTTGAAGTTTATAAGTCCTGAAAAATTCT
GCTGCTTCCACTAAGTCGCTTCAAACCGCGAAAGTCGACATCTCAGTTCAGGCTAAGATTCTGCACCTTGAAGGCGAGTAAGCTGCGGCAAACCCTCACT
CTTCAATTTGTCCTCTTCCGGATAAGCCACTCTCACTTCTCTTCAGTACCAGAACCAAATATGCAGCAGACCACGGACGACGAGTTCAGCACGCTAAAGT
GCCGCTACGCCAGCAAACGCTGCTGGAACCTGCGCGCCATCAAACGCAACGGCGAGCGTCACAACCTGTGCGAGATGCACCGCCAGAAGGCCAACAGTAA
CCAGCGTCGTCTGGATAAAAAGCGCAAAGCCGGCCAGGCCCTGGGCTTGGGCAACCACCTGCCGCTGCACG