Description :
From Genome Similarity Track
Location :
Scaffold_1461:4975- 6705
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1461-snap-gene-0.7Pantothenate kinase

Sequence
1730 bases(100 bases per row)
CGGGCTGCCGACGCAAACGCTTCACCGTGCACGTTGCTAACTTCCGCGTTGCGCAGGAATGCGCCCAATGCACCGAGATAGCCTTCGTGCTTGCAAAAGC
GCGCTTCCATCGTGCCTTTTGACCAAAAGTTAATCGCATACGCGAGCGTGCGCGACGAGATTTTGTTGTGACGTAGAAAGTTGCCCACAAAGAAGATGCG
CTTCGTATTGTATAAACACGAATTGAGGAACGCGATTTGCCCGATATTCTGCGTGATCATCACCAGCAGCGAGCGCGCGAGATCAGCGTCGCTCACGCTC
TCGCGGGGGACCGAGATCATTTTGCCAAAACTGCTCGCGACGGTGGTTGCAGGAAGGTTGAATTTGTCGTACGCTCCTCCGTAGATATCGCCGACGCTCA
TGTCCACCGAGTAGTTGGAGCCATCGACGCACAGGTCGAGCGCTTCGTCGTACGAACGGCATTTAGTCAGCAAACGACAGAGGCCCCAGTACGTTCCGCC
ACCGATACTGCTTCCGCTCACACGCTCAAAATCGCCTGGTCCTTTGACGTACAATACGCTCACACCTGAGCCAATACTCACGAGCTGCATGCACATAGTA
GGAGACAGAGATCACAACCGAATTCAGCTAGGTGAAAGCATAGTGGCAAGAAGTCCACTACCACGGAAATGAACGCACCAAATATGGGAAGATATCTTCG
TCTACTTCGTTGTGAATGACTTTGACACGTGACGCTGCAAGCGATTTAAAATCGACATCCTGCAATTAAAGCGAGCGCATACCAATTTGTTAGCACATTA
AAGCTCAACTAAACGACGTATTTGGTTGTGATTTTCATACCTCAAACGTGTACACTTCATCGGATAGCGTCGTGAGCAGAAAGTTTAAACCCAAAATCGT
GCACTCGATTTCGTCGAACTTCTCCAGATCAATTCCCGCCACTTCCTGGAAGAACGAACCATACTAGAGAGGCAAGTAATGCCAGCCATCAATAATGCGC
ATACGCTTATTCTGTTAATGGCCTCTGAAAAAGAACATGCTGTATACCTTGTGGGCGCCTCCACCCGTGCACGGCAACGAACGAAGCGACTGATTAAGCC
CTTTATTCGCGATAAACTGGATGGCCTCCTTGGTCTGCTTCGTCTCAAAGCGTATGAAATGGAAAACCTGGTGGCATCCAACGAACACGCAGAACAGACA
TTAATGACAACGGCCACAATCGCATAAACTCGGCCACATACTGCGAAGATTTACAAACGTACGCCTTGTAGCGCCTTAGAATACACTCGGAGACGCACGT
CTTGCACCCCAGTTTGGCCAAACATCTCGTGCTCCAAGACGAACTTGGTCATCTCACCCGCAGCGATGACATGAGATGGCGAGCGTGGTCTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCGCAGACTCACGCTTCTCAAAGTACACGATCTTCGCCAGCGTACCTCCTACATAACCAAACAACAAGGCTCCTGTTCAGC
ATTTCTAGGACATGGCAGAATAAAAAGAGAAATGCGAGGGGGGAAGCATACCAATATCCAACCCAAAGCAGTGTCCTAGATCCGATCTGCAAGATAAACG
TATAGAGAGAGAAAACACAGCAACCTCAATGACTACACCACCACCAAAAGATGGCCATTTGGTCACGAAGGGAAGGAGAACTCGTACGTCTTGGAGATCT
TCTTGAAGGTGACGCGCTGGCGCCAGAGGC