Description :
From Genome Similarity Track
Location :
Scaffold_17:497488- 499434
Transcript NameFunction/comments
Physo_156378Monooxygenase involved in coenzyme Q (ubiquinone) biosynthesis (ISS)

Sequence
1946 bases(100 bases per row)
TAGAGCACCAAAAGTGCGGGAAGCGCTCGCCAACGCGGAAGGTGGGCGAGTAAATGATGCTCTCGCCATCGCCAATCTTGGTACGGAACTCCACGGACTG
GTCCAGCGCTGGGTCTTCCATGAGTTTTTTCGCGCGGGATGCCCACAAAGGCGCGTCGTAGGAAAAACCGATGTCGAAGTGGTAAAACATCATGCCAAGC
GTCTTCCGCTTCGTCACGATGTCTTGAACGCTGGCGCGCATACGGTTACCCAGTGCGCTTCCCGGTCCGCCAGCGTCCTTCGCTTCATCCAGCAAGCCCA
GAGGCAGCTTACCAACGCGCATGATACGCTGCGCAATCTCGCGCTGGGCACTTAGAGGAAGGAGTTGCATCGGCGCCGAGTTGATAAACTTTGCCAGCGT
CTGGGCATTGTCGTGGGAAACATTGAGTGCTCGCGGAATCTTCATAGTTCGAGCCACGTTGCTCAGACTGAACTGGGTGTTTGTTTTGGCAATCAGCTGG
CGCTCACGTCCGTACGAGTGCAACAGAGCTGGGGTGTCAAGTTCGCCGTTGGTAGCCGACTTTGCATCTTTCGCTTGGATTGACAGCGCAAGTTTCCAGA
CCAGATTGTGAGCGTCCTGTAGCCCCGTGTTCATGCCGAACCCACCTGCAGGAGGGAACTGGTGCGCTGCGTCGCCAACAAGGAACACGCGCTGCTTGCC
TGCATCGTATTGCTTAGCCACGCGTGCCCCCATTCTCCATTGACCAGCCGACAGAATGTTGATGTCTTCGTCGCTAACCTTCACGTTCTTGGGAAGAACA
TGGCGGACGATCTCCTTGCATTGGGCCGTAGAAAAGTCCCAGGGGATCGACTCTTGCGGGGGGAAGAATGGGATCTGGAACACCCACTCGCCTTTGTTCA
GGTCGTGGGCGATCAAGATACCAACAATATCCTTGTTGAACTGAAACGCACAAACAAAAGCTAGGTGAGCGAAGTTCATATTGGACAGCAAGAGAATGTT
TCATACCACGAAGTACAGCATTGCTGGGTTCTCGCGCGCAGCTTCCGATAGCGCCTTGCTGGTAAAGTGCACGTTCGCGATGCTCTGTAGATTGCGCGTT
CCAACCATGTCAATTCCGCAGAGCTGGCGCACTAAACTGTGTGCTCCATCGGCTCCCACAACATAGTCATATGACGCTTCCTCAAGTGTGTTGGTATCTC
TGCACAAAGCACGCAAAACCTTATCAATATCCGTGGCTGGCATCGACATTTTGAATGCATGTCACATACAAGTGACGCAGCGTGACCTCAGGTTGTGCTG
TAGCTTCTCTATCGGACGGCAACTTCAGGCTCTCAAGTTCGACCCCACGTTCTACACGCACATTGTTCTCGGCCAGGAACTCGTCCAACATCGTCTCGAA
GCGGTTCTGCGGGAAATGCAGAAACTGCGTAGGCGAAAGTGCCGCCAAGGACTTGCGCAGACTGTCACCATTAGCTGTGGCCTGTTCGATTGTATCGCGT
GGGATGCCTGTCCGACAACATCGACAGCAGCGGCAACTTCAGTGTCGACGTTTCTCTCCAATTCAATCCAGCATAACGTACAGGGGCCGAACTGATCGAT
ACGCGCGATCTCCCGAGCCTTGCCTACTCCAGTGCAGTAAATGTAGTCGCGCCACTGTCAACACACGGCAGCCGTTGCACCCAAAACTTAGTCGTCACCC
CATTGACACATACAGTCTTGCCCTCTCTCTTACCAGAACGCTAGGCGCCGCCTGAGCCAACAGTCGGTCGTGGAACTCGGGCATTGTAGCGTAGAGCACC
TCCATGGTGCGGAGGTTGATGAAATGCGCCTGCGGGTGCGACGTGGGGCTGCGCTGGCGCTCCACCACGCGGGTGGGCACGTTGTAGAGCTTTTCGAGCA
TGAAGGCAGTGGCGAGGCCAACAGGGCCGCCTCCGACCACCAAAAC