Description :
From Genome Similarity Track
Location :
scaffold_48:49745- 51105
Transcript NameFunction/comments
g7427.t1hypothetical protein

Sequence
1360 bases(100 bases per row)
GCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGAACTCGCTCAAGGTGAGCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGG
ACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCC
GCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGT
GTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGA
TCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTCGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACAGC
GGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGAGGCTGAAGAAAGAAGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCC
TTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGATGCATCCGATTTCGCGA
TCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACA
TGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTG
CGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGT
TGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTC
GTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAG
CTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGC
CGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGG