Description :
From Genome Similarity Track
Location :
Scaffold_322:4974- 6848
Transcript NameFunction/comments
Phyke_g8340hypothetical protein PHYSODRAFT_504710

Sequence
1874 bases(100 bases per row)
CGCCATCTTTTTCGTGCGCCGGTCGGTCattcgtctgcagctccggtCGGTGCCCCCTGCACGTTTTGATAAACTTTTTCTTGCCCAAGTTCCTTCATTT
CCCGATTTGCGACCTCGGCCTCAAGACACTCACTTCGCATTGACCGGTCGACCATGCCGAGGAATACCGGCAGCACCAATCCTGCTGTCAACGACCTGGA
CATTCCTAAGCGTATGTCGTTCGTGAGCGGAACCTCACAGGGCAAAGACTTGGAAGAGGGCAGCTACACGGGTGTCAAGACCCCTGATGGCGCTCCTGGT
GGAGAGTTCGAAGGCGGTGCCCTGCGCCCAGGCGGCATGCCCGTGTTGATAAGCAAGGAGAACTTGGGTTTACTGGTTGAGTACGCCATCGTCGGCCTCG
TTTATGGCTTGCTTCCTGAGACTATCTACCCCTTCATGCAGCAATACCTCAACTGTTCTGGTTCGCAAGTGGCTGCGgcgaagcagctcgtgaCGTTGCC
ATGGAGTTTCAAGGTTTTCTACGGCATCCTGTCTGACTGCCGTCCTATCTGTGGATACCGTCGTCGACCGTACATGCTGATCGGTTGGGGAATCTGCCTC
ATTATGCTGCTCGTGATGTGCATCATGCCCATTGGGAAGCCCTACTATACGGTTGCGTCGGATCGCAACGTCGCCGTTGCTGACTACACGCCTGAAATTG
AAGCTCGTATCAACTACAATGCTTCTTCGGAAGGTGCCAAGTACGTTATTATCATGTGCTGCGCAGCTATCGGCTACGTGATGTCCGATGTCTGTGCTGA
TAGTATCACAGTCGAATTGGCTCAGCGCGAGCCGTTGGACAAGCGTGGCAAGACTCAGTCGATGATCTACACGGTTCGAACGGCCATGGTGATCTTCGGT
GAGATCCTTGTGGGCTTTTTCTTTAATGGCGAGGACTATGGTGgcgacttcgacttctcgTTGAGCTTCCCGCAATTGATGATCGTCGTGACGGTGCTGA
TGCTTCCAGTTTTCCCAATGACATGGTTCTTCATcaaagaagagaagaaggaggctgctAATTTCCGCCAGTACATCAGTGCTTTTTGGGACTTGCTGTG
TACTCGTGCAGTGTACCAGGTTATCGCGtacaacttcttctccaacatTTTCTCGACCATGACATACACTGCCAGCTCTCCGGTTGCGTCCTACATGGTG
GGTGTTACCCCTCTCAATACCACTCTGAGCGATATCCTGAGCAACTTGCTATTCATGAGCGGTATCATGATCACTTCAAAGTGGGGTCTACACTGGAACT
GGCGATGGATGATCGTCGGCACTGCTGCCACGCTGATTGTGGTGGACTGCGTGTGCGAGATGATCGTCATTTGGGATATCTTCCGCAACCAGTGGTTCTG
GCTTGGTCCTCCTATTGTTGTTCAGCTCCCGTATGGCGTCGGCTGGATCATTTCGACGTATGTGACGGTGGAACTTGCTGGATTGGGCAACGAAGGTGCT
GTCTACGGTCTGATCACTACGGTGACCAACACAGCGCAACCGTTCGCAacgtcgctgtcgcttctcGTGGACGGTCCGttcaacatcaccaacgaACGAG
TGCAGTTGGATGACCACTCGATCCGTATGGACATCACATAtaccatcatcatcatgtACTGCGCTATGATGTTCGCGTGggtgttcctgttcctgctgcc
aAAACAGAAAGAGGACACGCAGAGACTTCTCCGCGAGGGTGGCAAGAGCAGGCTCATCGGTGGACTCACGGTGTTTTACCTTTGCTTTGCCATCGTGTGG
TCGGTTGTCACAAATATCCTGGCCATTTTCGACAGCACGTCGTGCTTGATTATCGCTGGCGGCACTGGTTGCTA