Description :
From Genome Similarity Track
Location :
Scaffold_39:4974- 6412
Sequence
1438 bases(100 bases per row)
GGGTGGAGCAAATGGAAACTGATCGTGGAATCTCCAGCCAGGATCGCGACTCCAGTGGTCGACTCGTTCATCCGTTCTTGCAGCCTGCACTCAAGTACCC
TCGATACAGAGTGAGTCCAATATCGCAACGAAACATACCGCGAAAGCTAGTCTTAATCGATCTTGTACATTCATTTACCCAGGTTGAAGACCCCCGAACC
TCATCAGGAAAAGCGTTCAGTGAGAGCTGTATGCCCTCGGATCACTTGTTCTATGGTGCCTACCAAGATGCTGACGGGTCTGATCGGGGCGAAGTGAACG
GCACTCTTGTCTTAGACTTGTGCAACTGGGACACACACGCACTTGCCACGCTAGTGCTGGCAATCGTGGCAGAAGAAGTGGTGCGGCCTCAATGTATGTT
TATCTGTTGACTGTGAATCGTGTCTAACTCGAATTTTGTGGCAACAGAGCGGCTACAAGGTTTCGCTCAGCAAGGGTGGCGCAGGCATAGAAATTACGGA
GCGGATGTCGTCTGTGGGGACAGGTGTGTGTACACCTACGCACCTAAATGTCGAGGTTTGGACATCAAGCACTATGGCTGATCTCCGAGTGTTCCTCAAC
GAGAGCTATCAAGTCGGTGGGGTTGGGTACTATGGACTATCGGGTCTCTACACTACTCGTGAGTTTGTGCTCGATGGGATGGGTGCAACGCCGCCGTATT
TCCCCGATTTCTGGAAGCACTACAAATTAAGTGAAGATCTTATCCAGGCGCTGAGCGTAGTGCCCTTCAAAGCCAACGCAAACTACTACCCTCCAGCTGA
CGATCTCTGTCCGGACGGCACCATGGGCTGCAAAGACAACTGCGAAAAGACGGAGGCATGTACACAACGCGAAGCTACAGGGGAAAACTGCCTAGTGATG
GCGTTGATGCTCCCCGATTACGACCAAGGCTACTTTCAAGCCGTATTCGCGAACCTTGGTATACCCGCCTACTTTTGTTTCATCGACTACGGTGGAGTGA
ACAAATTTGCTGAAGATGCGGCAAAAAACGGCAACCCAGCCCTCTTTTACCACTATGAACCTGATCTCTTCCACGTGACACACAAGAATATGTTTGCCCG
GGTCGGTTTGCCACGTACGGACCCTGAGCGTGTAAAGTTGGCGACAGGAGACTACGGTGAGCACGGCTTCGGCGCCAAGACCGACAATCCAGTCGATGTG
GATTACCCTAGTTTGCCCCTCGCAAAGTTTGCTGCGTCGGTTGTCAAAGATCAGCCCATTGCCTCGTTATTCTCCAAGCTGACACTCTCGGATACGGATA
TCAATGCCCTTCTGAGCGAATATAGTACCGCCTCGGATGACCCTGAGCCGTATTTTCGCGCGGCGTGTACCTGGGTGAAGGAAAATTACGATACCTGGAC
TGGGTGGCTCGATCGGCTACCGTTGTGTATATTTGAAG