Description :
From Genome Similarity Track
Location :
Scaffold_5:49710- 52156
Transcript NameFunction/comments
Physo_128517hypothetical protein

Sequence
2446 bases(100 bases per row)
ACTGGCTACGAGTGGTGGGCGAAGATATTCCAACAACTAAAGTTCTCTAATAGAGAACTACCGTCAAAGAGATATGTACCGAGGGCGAAGGAAAATGAAT
TCAAGAGGGCTACGACTTAGGCAGCGATTCGGAAGGACTATCTGATCAAGGAACTGCTGACATCCTTTGCGGTCTACCATAGGAGGAACGTGGAGCGTCT
GGGGCATACGAGTGGCCACTTCGCTTGGCCAGAGCCCAGCAACACCGACTCGGAAGGGAGCACAAATACGACATCCCAAGAGCTCGCTCAAAGAAACGCC
ATCTGGGAAGGGGAAGTCTACGCGCGACTGATGCTGCCTGTGCTCAAGAAGACCAGGGTGGTGATGATCGTTCCGCCAACCGCGTGATGCGATCTGTTTC
GAGATGCCGAAATCTCACGTGAGGATATTTCAGGCATCGATTCTGTATCTCCACGAGGGCCCCCTCCTTGAATTCGCGCAGAGTTCAGCAACCGATACAA
GTGAAGCGACCAAACTCCACGCCAAACGGAATAGCAACAGCGATAGAGCATCACGACGAAGTGGCAGCCCGGCTTGCCTGTGTCTCTAAAAATCGAACAC
TATCTTGCAAACTACACGAGTGTACCTGGTTTGTAGGTTTCTTCTGTCAAGTCACACTCATAGTTGAGTAAATTAACGCCCCATCAGTTTCTTTTAACAC
GAAACCTGTGCCGTGTTGCCGTGTTGCATTTAGTGGTCTGTGCAACCTCTTGCTACCGTGGCTTCATTTCTCAAGTAGAGAAGAAGTGGCAAGCAAGCAG
AGGCTGGTGCGACCCCGTAATGCAGGTGCTCCATGCTTCAGAAGGCGCGAGTCTTGAGGTCCCTCCGTGCGAAGTCATGGTTGATCGAACCGAGGATGTC
GGTGAGGTCAACGGTGCCGCAACAGCAGAGTTCCGCGTCCGACGTACAAAAAGACAAGACAAAGGCTGTCGACGAGACCAAGAGCGACGACGCTGTTCGG
CCAGGCCAGACCCTAGATGAGTTTCGAATGCCGGCCCGTGACGTGTTCTTTGGACTCGTGTTCGACCAGATCCTGCTCGTTGGCTGGCTCACCGACACTC
TCATCCCTACCGTCTTCACTACCTCCGACCACACTGGAGCCCCCTTACCCGAGTATGAGCACGGACGAATCGGATAACATGATGCTGGCGGTCGTCATGG
ACGCGTACGGAGCCATGAACAAGGAGGGGGAGAAGGGGCTTCTCAGCAAACTCCTCGTCGAGAGGATTAAACACTTGTGGATCAATCTGTACCTAGAATT
TACCGGAACCAAGCGCGCGAAGGACACCCGGCCCGCGTTAAGCCTAGTGACAACGAGAAAGAACCAGTGGAGTGGTTCGTGCTGACGCTGTAAATGCTGG
CCCCGAGTCGGAGCCCTAGGTCCGTTCAACACTGCTACACTGTAGTCGATCCACCCACCAACATTGAAAGTTACTGCTCGGAAGTCCTTGTGGTTCATGC
CCGGCAGGTCCATCCTCCATTCTGCGGCAAAGCTGCAACTGGGAATGCAACGGACTTCACGTTGAGTTCAACTGAGACCTCGTGCAGAGGAGTGGCGGCA
GCGGCGCCTGACCCGACCACTGCCCGGTTGCGTTGTGACTTGGTGGCTCAGGACTCACTTCCTTATTTGCTAAGTATGAGCGGTGCGTTGGTGGAGCTCG
GTCTGCACGCGGTCTTCGTGGGGGCCTTGTTGGCATATTTCAATGTGCTGCAGTTCGGCCTCCCGGTCCTAGCCGCGTTAGTCGTTGCAGCCTCCGTCGC
CATGTTCGCTGGGTTTTGCTACGCTGCGAGGCTGCATACGACGTCGCTCGTGCTGGTCCCATTCATCGCCATCAGGTTGCAGCTCAAGCTCGCGTCGCTG
TTTGCTGCCTACGCCTCCAGAGGATTCAAGCCCACCTTCCCGGAGTGGACTCTCGCCTACGAGCTCACAACTTTCATGATGCGGTACATGTTTGAGGAGT
ACGGTCACACCATTGTGGACGACAACACACACTTGATGCGTGAGCCATTCGCGATGCACGGGCGGTTGATCCTCCACTCGAACTACCGCCAACACAAGAC
GGTTCCCGAGAAGCTGGTCGCTAACGGCATGGAGCATATGTGGCTACGTGACACCGAGACGAAGGATCAGCGCATCGTTGTCATTCACTATCATGGCGGG
GGCTACTGCATCTCGGATCCGCTGCAAGATGTCGAGCTTGCCAACCAGACCCACTCGGTGTTGAAGCGGATCCTCAAGGACCAGCACAATCTTGAAGTGT
CAGTCGATGTATTGCTCGCCAACAACCGGAAGGCGCCGGAGTTCCTGTACCCAACAGCTTTGAACGACTGCTTCGACATGTACAAGTACGTCTTGAAGCA
CGAGAACATCGCGCCGGGCCACGTCGTGCTCAGCGGTGACAGTGCA