Description :
From Genome Similarity Track
Location :
contig_142:4970- 10028
Transcript NameFunction/comments
g13671.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g13672.t1hypothetical protein

Sequence
5058 bases(100 bases per row)
TCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACG
CGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGT
AGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCA
TCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCC
CGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGT
CACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACG
CTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGC
AGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGC
AGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATA
CCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGT
CAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAG
TGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAA
TAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCACGTGATCTTGAGCTTCAGCTTCATG
ATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGT
TTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCA
GCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCAC
GACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATC
GCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTT
CCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGC
GCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACT
GCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGT
ACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGG
GCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTTGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATG
AGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGACTTCCAATTCACAGCCCGGCTGTGAATGAACACGTCGTCAAAATAGCTCGGTG
CGCGACTTCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTTAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCAT
GCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTC
GAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACC
CGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGAT
TGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGT
AACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGC
GTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGAT
GCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTA
TTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACA
CTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTC
CAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTG
CAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCT
TTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCG
AATCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATCTTCTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTC
CGCGCTGTCTCTATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCAC
GATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGC
TCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGAC
TTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTT
CTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCA
GCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATC
GCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGA
CGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCAC
ATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACA
GGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGT
AAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTG
AACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCT
TCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCA