Description :
From Genome Similarity Track
Location :
Scaffold_691:497- 1584
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_691-snap-gene-0.5Poly [ADP-ribose] polymerase 2

Sequence
1087 bases(100 bases per row)
TATTAGCCTCACCATTGATGCCTGACGCGAGTGCATGCATGCTGCTCGTCTATGGCTAGCTACACGTGGATCGAGCTCGACTACTCGACGGGCACGCCGT
ACTCCGAGTCGCTCACGTCGGCGCTGGCCGACAACCAGGGCCAGCTCGACCGCATCGAGAGCAACCTGGACGAGTACGGGCTCCTAGTGCCGCCGGCGCC
GCTCCCGGTCTCGCTCATGTCCCCTGGGGCCACGCTGCCGCTGCTCTCGACCATCACGGGACGCAAGCGGCGACGCACGGCGTCAACCAGCACGCGGCGG
TCGCTGGCCGCGCAGTTCGAGCTGTTTGAACAGAGCGACGTCAAGACCACGGGACGAACGCGGGTCGCGACCGCGGCCACCGAGGTAGAGCTGAAGCACC
CGCCGCCGTCGACGCTGCCCGAGGCCGTGCAGACCTTCGTGACACTGATCGCGGACCACGCGGACGCGGCCTACGCCTACTCGGCCGTCCTGCCGGACGA
CTCGCTGGACGACGGCGTACTGCAGATGCCGCTCGGGCGGCTCTCCAAGTCGACGGTGCTGCGGGTAGAGCGCAGCGCTTTGAGATGTCCTGATCTTTGC
TCGTTGGCCATGCTAACGATGAAATGTGGCAGGGGTACGAGACGCTCGAGGAGCTGTACGACGCGCTGAGCAACCGACAGGCGTCCCGCGAGCGGCTCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTACGCGCTCGTGCCGCACCACGCGAGGCTGGAGGTGATCGACTCGATGGTCAAGCTCGGCCGCAAGGTCG
CGCTGCTCGAGGAGCTCAGCCGCGGCCTCCACGCGGAGGACGTCGTTCGGCGCTGCCGCGCGCGCAACTACGTGGACGAGTGCTACGCGCTGCTGGACTG
CGGGCTGTTCCCGCTGGAGCGCGACTCTGCCGAGTTTGCGCGCATCGAGACGTACGTGAAGAACTCGAACTGCTGCGGCAGGAAGCAGGACCGGCTCGAG
CTGCTCGGCGTGTTNNNNNNNNNNNNNNNNNNNNNGAGGTGCACAAGCCCGAGCTGGAGCGCCGTTACGAGCCGTTCCGCAGGTTCC