Description :
From Genome Similarity Track
Location :
Scaffold_1648:4969- 6182
Transcript NameFunction/comments
Phyag_g11178hypothetical protein
Phyag_g11179hypothetical protein

Sequence
1213 bases(100 bases per row)
GCTCTAACGGATTCATCTACTTTGTGACCTGTACTTTTGCTCAGTGACCTCGAAAATCCGTACGCAGATTTATCGCAGTACGACTACGGTGCCCCAAATG
AAATTGCTGACGCAGACCCCGACATTGAAGATATCTCCGACAACGAGGTTAAACGTGTTTTGTATGCTACGCGCTATTCAATTCAATGCTCACGTGTTGC
GTTTCATGTCACCATTTCAGCGGCCCTCGATGTCTTTGACCAACCCACGTCCACCGAAAGTACGGACCGAATTGAAAGAGTTCGAGCACTTTGTTTGCAT
GGAAGACTTGCATGAAGACTATCGATGCCGCATCAACTACAGCAAGATGTTTGCAGGCCAAAGGTAAGCTTCATCTAGCCTCTGACATTGAGAacctgct
tcttcaaacTCATTTCCTGCATGTCTTCAGGTCCCGCAAGTCGTATGCCGATCGTCTTGCTGAAAGAAAAGCGCAGTCGCGGAAGCGCAAgcgagatgct
gctcgcAAAGAGGCAGGACAagcgtcttctcctgctccacgaGGTGGTAAAGCTGCCAAAGGTGgcaagaagcggaagtcACCGGCTGCACCACGACGAG
GTATGGACTAGTGCTTCACGGGAGGTATTCCTTCTGGGTCTCATCGCTTGATTCTATGGACTAACTCGGTGACTCGGTTTTGTTGTGGCGATTCTGAATT
CTAGCTTCTGCAGGCGGCGCTAAGGCGCCAAAGGAAAAGAGATCAAAGCGAAATGGAGCCTCAGCACGTCGGGCAAGTTCAGCGACGAAATACTCTCCAG
GCATTAACCACTACGATGATTCTGCGGCTGAGCTTGGCGAGGACCTGTCCACGATGGCGTGGGAGGGCGTCGGGTCTGCTGGCTACCTTTAACTCAATAT
CTAATCCGCTATTTAACTCGTGATCCTGCTGGGAGTcacgcagcgcctcggcCTTCTGGACCATGGCGTCGCAAATGTCCGCCTCCTtccccagcttctg
gagagctgacagctcaaagcgatctGCCAGCTCTAGGATAGATGCCGCCTTCGGGCCGCgctttggcgttggcgttcccctcgcgtcgaagcgctgttTG
ACCACGGCCGCGGAGCAGTCGTAGCGTCGCTTCACTTGGAGCTTGTCTTCCTTCATGAGCTCGCCAGTCCACTACGCCGTGGTCCTGATTGACACTGGAG
GCAGTCTAGCACC