Description :
From Genome Similarity Track
Location :
contig_61:49685- 52098
Transcript NameFunction/comments
g10846.t1hypothetical protein

Sequence
2413 bases(100 bases per row)
ACAGAAGACCATTTTAGGCAAGAAGCGCAGAGTATGAGCCGCCTGGTGCCATACCGGACGAAGGTGTCGGAGGACGTGGCAGCGCGCATCGAGCTGACGC
TGAACACAACCATGTACCTGGTGCAGACAACGGGCCCCACGTCCTACGTGGTGAGACTGCTACACGCCTCTTTCCTGGGGCTAAATGAGTGAGTCTTAAC
GATTTGGTCGCTGTAGATCCAGGAACAGAACTGCGAGAAGAAGCACAAAGTCCTGATCGGATCCTTGCAGACCTGCAGCTGTGGCACGGCCGACATTTGC
ATCCACATCCTGTTTGTGATGCTCAAAGTGCTTCGAGTGCCCGCGACGACGCCCGTTGTGTGGCAGAAGTCGCTCATTGATTCAGAGGTGTGTGGTGTGT
GTGTGTGTGTGTGGGGGGGGGGTCCTTTGTTCTATGGAGGTTGAAGTTTCTGATTGCGGTGCTGTGGCTGCAGATTGAGATGCTGCTCCGAGGAGGATAC
AAGCAGATGACAAGACCGGCCCCAAAGCCGTACAGAAAAAAACAGAAGGAAGAAGCGGCGACTGCGCAACCTGAAGATGCAGACGTGAATAGGCACGATC
TGGTGGAGGGGGAAGTTTGCGCTATCTGCCAGGAAGACATGGAGGACAGCCAGCCGCTCACTTTTTGCCGCAAAGGGTGAGTGGTCCTTGCATTAATTGG
TGGCTGTATTCTTTACTTACGTCTTTCGCTGCAGTTGTGGCAACAATTTTCACATCGAGTGCATGAAAGTCTTTGGCGAAAGTCGGAGGCAGTCGAAAGA
AAACATCATTTGTCCGTTGTGTCGTCAGGACTGGGGCGAAACGGGTCTGTCTACGTTGCGAAAAGAGATGGATGCAGCGAATAGAGCTCCCAATGTTCAT
AAAGGTGCGTCGTGCAGGAAATGCAAAACAAAACCGCTTCGGTGTGAGCGTTATCGCTGCGTTCAATGCAAGAATGTGGATTTGTGCGCTCGATGCTTCA
AGTCGAATGCTCACGAAAAGCACGCGTTCGTGGTGAAGTACAACGTTTTAGACTCGTGGGTTCCAGCTTTGCGTGACAACCAGCCCCGAACAGCAATCAG
CTCGGATCTAATACGAGACCTGGAAAACCGAGAACTATCAACAAATGATTATGACGTACTGCTGCAGCTGGACCAAGGAGGCAAGCACCCTATTCAAGAC
TACCTCGTGAAAGTGCTGCCAGGCACCAAAGTCGATGCTGAGAATGCCAAAACGTTTGGTGATCCTGGTGCGACGTGCTCGTTATGCGCTCAAAGTCTGC
GAATAAGAGCTTCTCTGCATTCGGTGCTGTGTGGGGTGCGTAACTTGAGACTGCTTCATGTAGTTCTCTCCATATTTTCTAATACGTTCGCTTGTGTGCG
TAGCACGTTTTCCACGAGAGCTGTCTTGCTCGATCCATTTTGTCCCAAGTGTATGAATGCCCTTTTCCTGGGTGTGACCAAGCGCTGTTGCCGGGGTTGC
TGTATCTTCAACAGAAGCACAAAACTAGCAAAGCTGAGGTTTCAACTGAACTGAAGCAGGAACTATCAATTGCGATGTCAGTGCTAGATTCTTCGTTCAC
CGTACTGGGACTTCAGCAACAGCGCTTGGGTGGCCAAGGAATTGGAAAGGTGTCAAAGGTAAAGAGAGGTGGGATACACACTCGTCGAGAGGATAGTCTT
CCTTCAATATCGGGTATTATCTCGGTGGGAATTGTACCGCATGAACGCCACAGCGCACATACGCCCGCTTCAAGAGAGCGTATGTCCACGCCGACGCCCA
ATCAGTTAGAGCACGAAAGCATTGTATCGATAAATTCCAGTCGGCCAAGTTCTACCCGCGCAAAGGGAAAGTTGGGCAAAGTAACACGAGCACGATACGC
TCTTCCACCCCTCGACAACCACCAACCACTTCCCCCGTTTCCTGTTCATGACAGCGTGACAGAAACCCGTCTCAATCACGCTGAGAAGATTCGCGCCGAG
CTGAAGGCTGTCGAGAGAGATCGCCTTCAGAAGCAGCGTCAGCAAAGAGAGGAACGCCAACAGCGCCACAAAGAGCACAACTGCAATCCAGCTTTTACAG
GTGATTTCTTGGATCGGAACAAACTGAAGTGCCCAGAGTTGCCAACAATATATCTGAACAGCGATCGCAGCAACGCCGCGAGTTGAAAAGGAAGCCAAAA
GAGCGGCAACAACGCGGTCGACAACAGAACGAACTCCTGATTACTCTTCCAGATTTATTTGTTGGCAGCAGGAGATAATGAGTGGTGTTGCGGGTCGTAT
GGATCTATCTAAACTAAATAATGGAATTGCGGCGAACGTAAGCTGACGGGTGAGGTGGATGAAGGCTGCCTGAGCTGTTCGAAAAGTGACCAGGTGACCT
GCTTTTCTTTCTG