Description :
From Genome Similarity Track
Location :
contig_61:49680- 52093
Transcript NameFunction/comments
g11332.t1hypothetical protein

Sequence
2413 bases(100 bases per row)
CGCGTTAGACAGAAGACCATTTTAGGCAAGAAGCGCAGAGTATGAGCCGCCTGGTGCCATACCGGACGAAGGTGTCGGAGGACGTGGCAGCGCGCATCGA
GCTGACGCTGAACACAACCATGTACCTGGTGCAGACAACGGGCCCCACGTCCTACGTGGTGAGACTGCTACACGCCTCTTTCCTGGGGCTAAATGAGTGA
GTCTTAACGATTTGGTCGCTGTAGATCCAGGAACAGAACTGCGAGAAGAAGCACAAAGTCCTGATCGGATCCTTGCAGACCTGCAGCTGTGGCACGGCCG
ACATTTGCATCCACATCCTGTTTGTGATGCTCAAAGTGCTTCGAGTGCCCGCGACGACGCCCGTTGTGTGGCAGAAGTCGCTCATTGATTCAGAGGTGTG
TGGTGTGTGTGTGTGTGTGTGGGGGGGGGGTCCTTTGTTCTATGGAGGTTGAAGTTTCTGATTGCGGTGCTGTGGCTGCAGATTGAGATGCTGCTCCGAG
GAGGATACAAGCAGATGACAAGACCGGCCCCAAAGCCGTACAGAAAAAAACAGAAGGAAGAAGCGGCGACTGCGCAACCTGAAGATGCAGACGTGAATAG
GCACGATCTGGTGGAGGGGGAAGTTTGCGCTATCTGCCAGGAAGACATGGAGGACAGCCAGCCGCTCACTTTTTGCCGCAAAGGGTGAGTGGTCCTTGCA
TTAATTGGTGGCTGTATTCTTTACTTACGTCTTTCGCTGCAGTTGTGGCAACAATTTTCACATCGAGTGCATGAAAGTCTTTGGCGAAAGTCGGAGGCAG
TCGAAAGAAAACATCATTTGTCCGTTGTGTCGTCAGGACTGGGGCGAAACGGGTCTGTCTACGTTGCGAAAAGAGATGGATGCAGCGAATAGAGCTCCCA
ATGTTCATAAAGGTGCGTCGTGCAGGAAATGCAAAACAAAACCGCTTCGGTGTGAGCGTTATCGCTGCGTTCAATGCAAGAATGTGGATTTGTGCGCTCG
ATGCTTCAAGTCGAATGCTCACGAAAAGCACGCGTTCGTGGTGAAGTACAACGTTTTAGACTCGTGGGTTCCAGCTTTGCGTGACAACCAGCCCCGAACA
GCAATCAGCTCGGATCTAATACGAGACCTGGAAAACCGAGAACTATCAACAAATGATTATGACGTACTGCTGCAGCTGGACCAAGGAGGCAAGCACCCTA
TTCAAGACTACCTCGTGAAAGTGCTGCCAGGCACCAAAGTCGATGCTGAGAATGCCAAAACGTTTGGTGATCCTGGTGCGACGTGCTCGTTATGCGCTCA
AAGTCTGCGAATAAGAGCTTCTCTGCATTCGGTGCTGTGTGGGGTGCGTAACTTGAGACTGCTTCATGTAGTTCTCTCCATATTTTCTAATACGTTCGCT
TGTGTGCGTAGCACGTTTTCCACGAGAGCTGTCTTGCTCGATCCATTTTGTCCCAAGTGTATGAATGCCCTTTTCCTGGGTGTGACCAAGCGCTGTTGCC
GGGGTTGCTGTATCTTCAACAGAAGCACAAAACTAGCAAAGCTGAGGTTTCAACTGAACTGAAGCAGGAACTATCAATTGCGATGTCAGTGCTAGATTCT
TCGTTCACCGTACTGGGACTTCAGCAACAGCGCTTGGGTGGCCAAGGAATTGGAAAGGTGTCAAAGGTAAAGAGAGGTGGGATACACACTCGTCGAGAGG
ATAGTCTTCCTTCAATATCGGGTATTATCTCGGTGGGAATTGTACCGCATGAACGCCACAGCGCACATACGCCCGCTTCAAGAGAGCGTATGTCCACGCC
GACGCCCAATCAGTTAGAGCACGAAAGCATTGTATCGATAAATTCCAGTCGGCCAAGTTCTACCCGCGCAAAGGGAAAGTTGGGCAAAGTAACACGAGCA
CGATACGCTCTTCCACCCCTCGACAACCACCAACCACTTCCCCCGTTTCCTGTTCATGACAGCGTGACAGAAACCCGTCTCAATCACGCTGAGAAGATTC
GCGCCGAGCTGAAGGCTGTCGAGAGAGATCGCCTTCAGAAGCAGCGTCAGCAAAGAGAGGAACGCCAACAGCGCCACAAAGAGCACAACTGCAATCCAGC
TTTTACAGGTGATTTCTTGGATCGGAACAAACTGAAGTGCCCAGAGTTGCCAACAATATATCTGAACAGCGATCGCAGCAACGCCGCGAGTTGAAAAGGA
AGCCAAAAGAGCGGCAACAACGCGGTCGACAACAGAACGAACTCCTGATTACTCTTCCAGATTTATTTGTTGGCAGCAGGAGATAATGAGTGGTGTTGCG
GGTCGTATGGATCTATATAAACTAAATAATGGAATTGCGGCGAACGTAAGCTGACGGGTGAGGTGGATGAAGGCTGCCTGAGCTGTTCGAAAAGTGACCA
GGTGACCTGCTTT