Description :
From Genome Similarity Track
Location :
contig_45:496779- 505414
Transcript NameFunction/comments
g9556.t1hypothetical protein

Sequence
8635 bases(100 bases per row)
AGCATGGCCACGCCACGTGCAACCCAGTGGGCCTCTGGTCTGCTGGTGGGCAGCCGAATGAAGCAGATGAAATTCGTCGAGTGGCCGGTAGTCGACAGCG
TACCTCGTCGCTCGCTGCAATCAAGTTAAATACCAAAGTTAGGATATCTCTGTTGCAGGCGACCAAATTGACACAACCGACCTGGTCTTATATACTGGGC
ACGAGTACGAGCTGCGTTGACTCATGTCGGTCTTCTTCACGGGGTTGAAAAGCAGCACAGGCGCCAAGGAGAACAGCACCTTCGGGTCTGACTCCGCCAG
CTCACTCGTCGCCTTGTCCCATTTGGCGCCTTCGAGGAACATCCCTCGAACGTACACTCCATCCTGATCATAAAAGTTTGTAAGCTTTTCTTACCTATTC
AACAAAACCTGCTACGGGTGGCCGTACCTTTGGTGGCTGCGCGTAGTCGTTCCGCGGCATGGGCTCGTGGTCGAAGCCCAGTTGGTCAATGGGCAAAGTG
TACTTTCGCGCGTAGTTTTGACTGGCACCCGTCAAGAACGCTTGCGTGAAGAAGAAACCCGAGATCCAGAAGACAACTGGCGGCTTCTCTAGCAGCCACT
TGTTGAAGAAGGCAATGCGCTCCAGCAGGTCAGTCACGTAGCTTCCCAACGGCTTCAGGGAAGGGTACGACTTGGACGCCCAGAGTGCTGGGATCTTGCC
GTAGAATAAACTCTTCGAAACATTTTCGAGCTCTGCCGACATGACCACGAGGCCCTTGAGTGCCTTTTGCAGGCTTTCGAGACTCGATCGGATTGTGGAC
ATGAGGTTGTTAAAGCGAACGAGTTCTTGACAGAGCACCGTGTTCATCGACTCGTCCCAACGCACCGGGTAGCGGATCTGTGCCACCTCCATGTCAAAGT
TTGGCGGTAAACGCTGCAGAATGTCGTTGGCCACGGCCTCCACGAGCTCTTCTTGTGACCCGCTGCTACCTTCATTACCGCCCCCTGAGCTCTGTGTAAG
TAGCACGTCGCGACATAGCTTGGCCGTTGCGTTCTGATCTTTGGTGATCGTGGCGTTATCATGGAGCCCAAACACTCCAGGAGGAGCCGCTAAAGGCAAA
CCTTCGATGAACTTGAGGTACGAATCGTAGTCGCCATCGGGTGGCATTGTGTACATACCTTGTTCATCGAAGGCGTAGCCCTCTTTGAAAACATCCAAAC
AGTAAAACTTGCCCAGAACAGACATGAGCGTACGGCGATCTTTGTCGTCTGTCACACGTCCACCGTAGTTACACTCACCGGTGCAATAACGCAATGCGCG
TAAGGGTAACTGCACGTTTTCATCGACGAACATGGCCAATTGGCGAATACTGATGCTCAGGTCAGACTCGTTGAATTCGTACTGAATATTCCAACCAAGA
GGGCCAAATTGCCGACGCTCGCGCACCAAGGCGTGGAAAAAGCACAGCGAGTAAAGAAGCACGCGGAACTCGGGGCCTTTGACCACGGATTCAAGGAAAC
CCTTCTCACCTACCGGGTCCGACATGTAAGAACCCATGAGATTAGCTCGTAATCCTTGCGGTGGTTCATTTGTCATCTTGACACCATTTTGCAGGACGGC
CGCTGGGAACACGTCCGACGGGTACGTTGTGCACCACAGCCGGAAATCTGGGTGCGTATTGTCTAGTTTAATATCTTCAGCAATCTTTTCCATCACAGGC
ATCCAGCTTGGCGCTAAATGGCAATTCTGTAGTACAACCCATGAGCCGGCCTCGCGAGCGCGTACAATCATGCGCTCAGCGATAGGACCTTGACCTTGGC
CCAGTGAAATCGTCTCCGCCTTTTGCCGAAGTGAGTCCGCAAATTTGAGCACGGAGCTGATCGGGTCTGATCCCGGCGACAAGATGAACACTAATGGCGA
TGAAACGCTGCTGTCCGAGTACGAAAGAGCCAAGTCGAACTGCGGGGGCTTCACGAATTTTTCACCCATTTCCTTGACGAGGAACTGTTGGATTCCAACG
ACTAACAGGTCGGGACGGATGCATCGTAGACTTAGGAGTCGACGGAACTCGCTTACTCGCCCCAGTGTCGCAGGGAACGGCAGTGTGTGGCCAACTGGAC
TATCGTAGACCGCCTTCCACTGGTCGTCATGGTCTATGAACTCCTCGATGATGCCATCGAATGCTGGTAGCGCACTTAACCTCGAAAATTCCGCCCACTG
CTTGTCGCTGAGCCACAACTTAGCAGGGTTTGGTGGCGGCTCGGAGAGTGCGATACCTCCAGTGAGCAAGAAGTACCACTCGCTGCTTTCGATCTCGTGT
TTGCCTTGTTTAATAGAAATGCATAGCAGAAAAGAAAACATGAGTTTGTCCTTCTCCAGCAAAGAACGGCAAATGTTGCGGTACAGCGAGTAAGTGAAGT
GGGCATCCAGATTCTGAAGTCGCTGGGTCAGATCCGGTGATCGATCACTGTTCAGGATACTAGCGATGAAGAGATTGATGAACCACGATAGAGAGTACTG
GTAGACGGGCTCAATGTTTGCAAGCTGATCGATGCAGAAGAAGAGCACTTGGCTTGAATAAGCCACCGGTTTGTATCCCTGTCGAACTGAGTCGATCTCC
AGCTCTGTCTTCTCAGCAACTTGCTGCTCCTTTTTGATCTCATCGGCGACTTGCTTACTCTGGTTCATGGTGTTGATAGCGTCTTCATCTTCGAGGATGT
TACCCTGTGACGAAGATAAAATGTTCAGAATCTTGTCTTCGATTTCCTTGAGCAACCCCTTGTTGCGTGCGTTCTGCACAATCAACTTGTTCTTTTGCTC
TTCTAGATCAGGTCTTTCCTGCGCCACAACGATTCCCAAGAGCTGGTCTTCAAGACCGTGAGGCGTGATCATAAAGTTCAAAAGCGTCACCTTCACTGAT
ACCTCTGGCAAATAGTGCGGGTTCCGATACTTGGTCGTAATGTAGAAACGAAAGCTTTCTGCATATTCAACGGTTGAGTCACCGAGACGAATACATGTCA
CCCCACCCTGTTTGAACGTTTGTTTTAGTAAAAGTGGCTCCAGTGACGGGTCCAGTTCCTCTGCAACGTTTTCAAGCAGCACGGGTGTGCCAAACTGTAC
TGAGTTCTCTAGAGTTCGCATATAGTCACCATCCGTTAGCTTAATCACCGTCATTTGGTTGTCCTTCTCCATATTACGGATCCATTTGTTTGCTTGGCCC
TGCGGATCAATCATCAGTGGCCATCGACGCGAATTGAAGACAATGATGCCGTTATCAACGGAAAAGCCGTCGGTCGGAAGTCCATCAATGTTCCACTTGC
GAATTTGTACCGCGTCGCCAAGAGATCCGTTCAGTGATGGCAGGTCACTGCAAGGAATGTCAAGCTGCTTGCAGCGTGCAACCCAGTCGTGTACGGCATC
CTGGCGGTATAATGAAGTGAATGGACCGAGATACGCAACAACTCCTGCTGAGATCAGCACGTCTCCTGTCAGTCGGCTGTACTGGATTGCCAACTGCTCT
GCAAACTCAGTCCAGCGTGTCTTTTCTCCCCCAAGGCTTTCGATCAGCGTGGATGCTCGGACAAGCTTTTTACCCGTGAGATCCACCTGGTACTCGAGGT
TTTCCTTTTGCTTAGTGGCGGAGTCAAACTGCCGCTGTAGCTCTGCTAGCCCGTCCTCAACCTCTTTCAATTGTGACAACTTTTCGTTCAGCTTTTTCAT
GACCTCGTCAAGTTGCTGCTCAGCTTCCTTTAGCGCTTCACGCTTGGGCGCAACCACCTTTGAAACGTTGTCGTACAGTGCCATAGCGTGCACCCATTTG
CACAGGCCTGCTGCTGCTTTTGAGGCCTTCTCAGCCTTTTCTGGACTGAAATTTTCATCGGCAATGTATTTGCTGTTGACGATTTTCATCGTTTTGGGGT
CGAGATTGTCCTTGTCGAACTTCTTCAACGTGGTGATGAAGGTCGGGTCGCTAAGCATTTTCTGCGATGGCCCCCAGTAATCCATGATACGCTTAGAAGG
GTCTTGCGGGTCTGGAATACGGGCTGGTTTGATACCAAGCATCACACAAACACCCTCGCACACCAGTTTCACACCTGCAGGAGGATTACTCATGGCTTTC
ACCTCGTTGATCTCACTTGGTTTGATAGTATCCAGGGCTTTTAGAGCCTCTTCCAGTGCTGGAATTGCTTCCGCTAGATCTGCTTCCACACTGGCCTTCT
GCTGCTCGCACTCTGCCTTAGAAGCGTCGGCCACTGCAACATCAGCCTGCACTTCACTTCGCTGCACTTCAACTCCAGGCAACTTAGCTTTGATTTCCTC
CATCAAAATGTCTGTATCTTTCTTAGACTGGTCCAGCACAGGTTGCAAGTCTTCGAGCTCCTTCCGCATCACCGCCACATTGTTTTCTGCAAAATTGATC
TTCTCGAGACCAATAACATAGCGATTGCGAGCACTTTGTACGGCTTCACGACGGCGCGCCAGGAAGCTTTTAAACGCCACGATGAGCTCTAAATAAGAGG
TCGGGTCACGTAATTCTGGCGGCGCAAATTCTTTAGGAACTTGTCCGAGAGTTCCATCACGCTTACGTGGAAGTATTGGCATGTGTCCACAATGGCTTTG
CGAACGTTGGCGCTGTCCATTTCCACGTCTGCTAAGAATTTTTCGGCCACAGCCACCAAAGCATCGGACGGCCACGCAGTGAACCAGTCAATCGTACAAC
AGTTAATTAGCGATGGAAACTTTCGTAGTCTGTCCCTGAAGGCATCGCCGATGGGGGAGCAAGCGAGCACAATGTGCAAGTTACTTCGCACTCGCTGCAG
GAAAAATGCATATAGCTGGGTTTGGTTCATGTTGTCTCCCACTGCTTTACCGAGTTTTTCCTTTACATGGGGGCGAACAGCTTCACAGATACCGACCCGT
TCGTCATACGGGAACAGATTTGGAATCTCTCCAGAGTTCAGCATATTGTTAATGTCTTCGACAAAGCCATCATACTTGATCTGCGTATCGCTAAACAGGA
ATACAAGTGGTCGCGCACCCGTACCAGCCATACGTAAGACATCCTTCATATCTTCACGCCATTCCGTCATGGTATAGTTCTTCGAAATTTCAATCTGCTT
GATTTCAAAATCAACGATAAACGCCGACAGCCGCGTAAGACTTTGACGACCACTGCCACCCACGCCAACAAGAAGTGCATTTCCACCCGGCATGTTCAGC
ACGCGAACAATCCGCGATAGGTGTTCGATAGCGAACAGAAACATAACCAGGTTCATGGGTTTCCGACTAATGCCATTGTACTCGGCCAAGTACCCGTCAA
GACACTGGATAAGCTGCGCGATACCGTCGAAATCGGTGTCCAGACGAACATCCACTTCTTTGTACAGCCTCGGACTTGCATCAGGGTCCATGTAGTCGCC
AAAGAACAGGTTTCGCATATCACCTGCTGAGACTGGACCTTCACAACCGCGTTTGAGGCTAGCAAATACCTTGTCAAAGTTCGTAGCAAAGTGCTTGATA
GTGATTTTCTTCTGCACATCGTTAAACCACTCCCGGTCTTCATCGTCGATCAAACGGTCACCGATCACGCGAAGGATTCGTGCACCCACAACTTCACCAA
GCTGTTGGCATTAAACTGCTCGCTAGGCACCACAAGCATGATTCCTTGGACGATTCGAGAGAAATCCCGAAGGTTGAATGTATAATGCGACTTCTTTGGA
GTGGGGAGGAGTGCACTCATAGCAGACTGATACAGCTCTAACGTTGCAGACACCACGGCTTCTGAGAGGCGTTTCACCTCCGGGATGAAGGGATTTGAGC
CAAAGTACCAATCCAAAATGGTAGTGAAGATACGCGTGAGTGTCGTGTCATCGAACTCGGAAAAGCACAGAAGGTTGAAATGGCGAAGTAGCCGAGGAGT
GACGCTGTTTCTTCCGCCACCAGGTGGTCCCATCGCTGCTAGCACAATAGTGTCAACAATCTTTCTCCATGACATTTCTTTGAGATCGTAATAGCCTTCA
CTGTCTATCAGCTGCCTCACCAATTCAATAGGTGGCTGAGCACCGTACGTTTCGACTAATGGCATATTCAGGTCGTCTACGAAAATAATGGCGTTCTTGC
CCAGGGGTGGGCCGAACACACCCTTGCGGCGCTTGTCGAGCTTTCCGTCGATAATATTCTGGGTCATGTTTGCCGACGTTTTTGCCGAGAACGACAGCAT
AATGACGGAATTGAGATCCTGAGGCAGTACCTCGTTCAGAATTGAGGTCATGTAACAAGACTTGCCCGTTCCTGTTGGGCCACAAACAAGCACCTTTCTT
TTGTTGGACACGAGAAGCTGAACGAGATACTCCAACTGAGCGGTGAAGATTGTTGGCACAACAATTTGGTTGAACGGCGTATTGGGCTGAATCACGTATG
GTTTGAGCATCTCCTCCCACTTGAACCACTTGCTCTCTTCAATGTCAAAGTAGTAGTCGTGCAGGTTGCCCTTGCCAGGCATTGGAAGCGCCAGTACGTA
CGTGTTTTTGCTGTCTTCAAACGCAGGCTTCTCCCACTTGCGAACCTGAAGTGCACGGCTTACAACAATATACTTACTCTCCAGTGCTTGAATATTCTCC
ATAATTGAGCGAACGAACTCACAAAACCTGATTCGTCCTTCAGAATTAATGCTCTCACCAACAGACCACGTGAGTGAGAACATGAAGAGCGCTTCGATCA
TCGCCTTTTTCTTGGACGCTGCATCTTTTGGAAGCTTGCACAATTGTGCCTCAAAGATGTGAATGAGGCTTTGCACAAGGTTCGTATCCACGGTCGGAGA
CAGCTCAACTAACTCCTTCCTAACAAAAGCAATGCATGGTTCGACGAGCCATGAAAACAGGAAGTAGATGAGGCTCCGCTGGTCATTGTTGATTTCAAAC
GGGCCCAAAGGAGGTTCCTTGGTACCTTCCACCAAGGTGATAGAGTCCAGCCATGAATTGAGGACTGGAATCCAGCCCAGTTGCTCAGGCTCCATGTAAA
TCATGCCACAGCGAGACACTGTCGCAGGTGACGCAACCAACAAGTCCATGGGTTCAAACATCATGCTCATGACCGAACTCATGGCAATAATTTCCCCGCT
CATCAAACACAATTTGCGGTTATCATCAAGCACAGTATTCATGTTTTCAATCCATACAGCATCCACCGGTCCATCAAACATTAGCCACTTGCGATCTGGT
GAGGGATTATTAGCCAGATTTCTGTAGTTAATGGCAAGCACTCCATCATTCCATTCGTGAGAAACGGCATCGAATTGTCCATAGAGCTGCCCCATCGTTA
CCGACTTGGGGTTGATCACTGACACGATAACATTGGTATACCGTTGATCGTTAGGAAACTGCTGATGCAGATGAGCTAGCACTTCAGACAGCACTCTCCA
CGAGCACGTTTTCCCTGAGAATGGCATTCCCACCACCATGAACCCGTGTCGCACAATCATCATTTCGTAGATTTGAATCACCTTCTCGACAAAGTTGGGA
ACTGGTTGTAGATTCATTTGTTTGCATACATGGTCGATCGAGCTCAGCATGTCTCTCCGATCTGGTGGATCGATCGTCACGCCAGGGAAAAGATCCGATA
CAATACCATTAAATAGAGGTACATCGGGGGACAAGAACTTCGGCAAATTGACGTCAATGATCGATCGCAACACTAGAGTATCTTCTCGCAGATGTCCTTC
GGCTCGTTTCAGGTTACCAGCAGCTCTAAGCACAGCCATGACAGCTCGCATCCCGTAGTCGTAGTGAGATTGAGATGACAGCTGTTCGGAGCACAATGTG
TAGGTCGTCGTAATCTTCTTGGAGAGAGCGCTTGCATCCATGTATCCGTAGGAGTACAACATTATCTCTGCAATCATAGCATAGTCCGGAACCATCATCG
CTACAGTGCGGAACAACACCTTCAAGTTGTCGGGTAGCTCTGCTCGGCCAGCATATCCGGGGTTCATCGTGATGAATGGACAGCAAGTAGGGTTTAGTCG
GAGTTCTGTGCCCTCAAAAATGAAATTTGCAAGGTTTTGAGCTTTCGCCAGCTGAATACAAAGAATTTGTTGGGCAATCACCGACAACACCTCCAGCTGA
ATACGATTAAATTCGTCGAAGCACGCCCAAGCACCCGAGCTCGCAAGACCCTTGAAGAATTTTCCCATTGCGAGATAATCGAGACCATCAGAACAGTTTG
TGACGACACATTGAATGGCAATAGCCTTTGCAAGATCTTTCGTCGTCTCTGTCTTGCCTGTTCCAGCAGGACCCTCCGGTGCACCACCAAGGTTGAGGTG
AATCGCCCCCGTCAATGTCCGGTAGCACCTATCCGTCAACGGGGTGATCACCAAACGCATACTGTTTCCAAGATACTCGAATGCATACAGGGCCAGTGTG
TTAATCATTCGACACTCAAGAGTATGAGGCTTACCTGTTGTCGCCGAGACCCCACCCTGGATCCAATAGTATCGCAGTTGAGCAAGCCAGTCGAAATCCG
TTTTATCCGTGATTTTCAGATCGACCAGCTCGGCAATCGTATCGCGGTTGTGTACATCCATCACCACAAGCGCTCCAAGCGTGATGCGAATTAGCTTGGT
AGCTCTCCACGCACCATCTCGACGGTTCGCTTTAG