Description :
From Genome Similarity Track
Location :
Scaffold_1600:4967- 7972
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_1600-abinit-gene-0.17Ribonuclease Z
Pytiw_DAOMBR242034maker-piw_contig_1600-fgenesh-gene-0.1SET domain containing 3

Sequence
3005 bases(100 bases per row)
GGTTTGTCAATCAGGCGAATCCGAGCCAATTGAATAGCGTTAGCACCACGAAGACGCCACTAAGAGAAGGATGACGCGGCTGTTGCTGGAGCTCACGGCG
GCGCCGAGCTGCTGGCAGCAGAACGTGCTCGCGAGCGTTAAGGTGGCCGTGAACGAGATCGAGCGCCTGCGCATCCTGGAGGACCGCAAGTGCTCGCTGC
ACAAGCAGGAGCCCGCGGCCGCGCAGCTCGCGGCCTTCGAGGTGTGGTTCCAGACCCACGCGAGCGCGGGCATGGACCACGACGAGGAGGTCAAGCTCTC
GGTCGCGCACGCCGGCGACGACGAAGGCAACGGACTCTTCGCGAAGAGCGCGATCGTCAAGGACGAGCCGTTCCTGTGCATCCCGTACTCGGTCATCCTC
GGCTCGCACTTGGACCTCGGGCCGACGCTGGCCAAGCGCGCGGCCTGGCAGCAGGTGGCCGACGACCCGCTGCTCAAACACTTCCCGAGTTGCATGCTCG
CGCTGCGGCTGCTGGGCGAGGCCTGCAGTGGGGACGCGTCGGTCTTCAGCCCGTACATCGCGATCCTGCCGACGCAGTTCAACGTGCCGCTCTTCTACAA
TGTCGCGGACTTCAAGTACCTCGAGGGCACGTCGCTCTTCGAGCCGGCTGTCAAGCTTCTGTACAACTCGATCAAGCAATACTGCTACTTCCAGGCGCTG
CTTGCGCGCATGAAGGCGCAGAGCCCCATCCCGCTCGACAAGTTCACGGTCGGCAACTACTTCTGGGCGCTCGGCGTCGTGCTCACGCGCCAGAACGAGG
TCGTCGTGAGCGAAGGCGAGACCGCCATGGCGCTCATCCCAGGTTGGGACCTGTGCAACCACGAGCCGAGCGATGCGATATTGACGTTCTCCGACCCGCG
CGACCGTGTGATCAGGTCCCACGCGATCCGGGCGTTTGCGGCAAATGAGCAGGTCAAGATGTTCTACGGCAAGCGCTCGAACGAGCACCTGCTGCTCTAC
TCGGGCTTTGTCCAGGACGGCAACGAGTACGACAACGTGCAGCTCGAGCTCCAGCTGGCCGAAACGGATCCGCTCGTCAAGATCAAGCGCATGATTATCG
CCAAGGAGGCCGACTTCGTGCCCATCAAGGAGCAGGGCAACCTAGTCTATTACCGCATCGACCTCAGCGGTGGCATCGTGTCCCCGGCCATGACGCGCGC
GGTCCAGGTCGCGAGCATGAAGAAGGCCAACCTGAGCGCCGCGTTGCGCAATCCGGACGTCGTGGGTTCCAAGACGCTCTACCACTGGGATGACGACGAG
AATCAGGCGTCGCTCAACGCCCACCGCGCCCGCTGCCAGTACGCGCGCGCGCAGATCCTAAGCCACACGGAGGTGGACCCAGAGGGCGCCAAGCACGGTG
CGCTCTTCCAGCGCTACTTCCAGTGCCAGCTCGACGTCCTGGACGCCGCGATCGTGAACCTCAATCGCGTCCAGAGCTGACCGAGAGACTGGTGGAGCCC
AGGCTGGGACGACCTGGTCCTAATTGTAATAAGAGAGAACGTGGCACGGCGACTGTGTAACAAAGGCTCTATGGGTTTGGATCATTCACTCACATCTCTA
TGCTCGTGTCGTCTTGTTCTTCTTCGGCTCGGTGGGGCGGCCGCGGAATCGCGATGCGCAGAAAGTCAGACGCGGGTACGACCGCGCGCCGGCCGAACGT
GTACTGCGCCTCGAGCGCCAGGTGGAGCGTCGTGCGCGAGTCGCGGATCTGGCTCCAGTGGCGGAATCGGTGGCTGAAGTGCGTAAGCGCCAGCAGCTTC
GCGTTCATCCGCTTGGCCGCAAAGCCGGCCATGCGCGCCGTTGAGTGGCCGCGGTGCACAGCCTGCGCGACCATCTCGTGGCTTAGCGTGGCCTCGTGTA
CGAGCACCTGACAATAAGAATCCAATAAATTAGTCCTACACAGTAATCCTATAAAAGAGTCCATCATGCTAAGATCACGTACGTCGCAGTTCTGGCCAAT
GTCGAACATCTGAGACGTGTCGGCAGTGTCGCCCAGGATCACGACTTTGCGGCCACGCGCAGGAGGACCAGTGACCTACAATAACAGTCACAACGCCAGT
CAGGCTCAGGGATTGAGCAACATTGCCACTCTCTGCATCGAATGAGCCCTTCATACCTCTGAGGCGTGGAGGGTCTCTCCGTTCGGGAGCGTGACGCTGG
CGCCGCGCTTGAGTTCCCGGTAGAGTGGTCCAGGAGCGAGGCCTCTCGCGAGCAGCTCGTCTGCCATTAGCCGTCCTGGGATCGTGTGCTCTTCCACCAC
ATACCTGTCAATCAATACCAGCGTCCTTCAGTTAGTCTTACGGACGAGTCATGCAGTTGCATGGTCATATACATACCCAAAGCTCGTGACCGTGTGCTTC
AAAGTTGAGGCCACGACTTTAACTTTGCCGTCGTCCAAGAGCTTCCACACGTGGCCCTGGCCGTCCCACTCGGCGTGGACCATCTCGCGCGTCAAGGACT
AGATTTCAATAGAACAGACACATCGGTTCGTATCAGAGCCAGCAATGTATATACACACAATAGTCTGCAATATAGTGCAACATACCGGATGAACTGGCGC
TCGGCGCATGAACTTCTCGTGTGCAGACGCGCTCTCGAGCATCTCGGGAGTCACGAGCTCGTGGACTGTGATGCTGAGGTTCGCGATGCGCGTGCTGCTG
GTTGCAAATGCCGTGTTGAGGTACGAGAAAAGCCCCAGCGGCCCGTAGACTGCGATGGGCCGCGGCACGTGCTTCTTCGTGCGCGAGTCGAGGAACTCGG
CGTTGTGGTTGTCCAGCGTGCACAGGATGCCCGGGAGGCCATACAAGTGGTCGCCGTGCAGGTGCGTGATGAAAAATTTGTTGGTGAGCGGCACGCGGAT
GACGCTCTTCATGAGCTGCCGCAGGCTGCCCTCGGCGCAGTCGAACATCCAGTTCTGCTGCGCCAGACGCAGACACACGGCCGTCGGGTTGCGCCGCACG
GACGG