Description :
From Genome Similarity Track
Location :
Scaffold_125:49666- 55120
Transcript NameFunction/comments
Phyta_totarag4130hypothetical protein PHYSODRAFT_397963
Phyta_totarag4131hypothetical protein

Sequence
5454 bases(100 bases per row)
ACTCACAGGAACTCCAGCTTGGTCAGTTCTGCTAGTGACGCTGGAATGGTGCCCACGAAATGATTATGATCGAGCCGTAGAGTGCGCAGGGCACTAATTC
GAGACAAAGTGTCCGGTACGTAGCCAGTCAAGAAATTGGAACTTAGATCTCTGCAAGCATCGTGACTTGATTAGCTTCCGATGATTTTAAGCGAGCAGGA
TTGCGGAAAGTGCGGCAAACTCACAGCTCTTGCAGGCCGCTGAGGTCTTTGCGAGGGAACTCTGGCGGTAGGACCCCCGCAAGGTTGTTATTGGCAAgac
gactgcaacagcaaacagcgaTAGCAAACATCAGGTAAGTAGCgaggcgtccagcagcagattaACTCAATCCCACTCACATGGATCGGATGCGGTTGTT
GCGGTCACACACGATGCCGTACCActagagcagcaacacaatACAGACGTATCCATGATAGGTAAGATTACAGTTGGGTACGGCCCACGCACAGCTTTTT
GCTCGCGTACGCCGTCAAGGCACGGGTCGCTGTGCTCGTTCTGAATGTCCCATTGAGCCACCCAGCGTTGGCCATGCGTGGCCCAGTAGAGCAACTTTAG
TGCGCCGCGTTCGTTCCTGGTGATAGCTGTCGATGGGTTCacccacgacagcagcaaaaagaCAACGGCAGCTGCGgtctggtggtgctgcatcaGGGCA
AAACTGCAACGCAGCCATGAGCTTGACACATGGCTACAATTAGATGATATTTTTCTACACGAAAAAAGGCAACTTTAGCTGCAAAGCATCGACTTTCAAA
AGTAGCTCATTCAAGACTGTACATGGAACTGTGTTCGGGCATGGTGcaagcactgctgcagcagcaggctggTTCGGCGTAGTAGCCATCTTGGAGCCTA
GATGTGTGGCATCGTCCGTGCTCTTTGCAACCTTCTTGTCCGGTGACCACTTCATGCCCCTGGGGTTAATTCGACTCAGAATGTATTCCTTCACGGGTGT
GGCTATGTCTAGGAATCCTAATATGATGGACCCTCCCCGATAAAGTAACGAAGCTACTTATCTCAGTCCCGTATAAGTTAACCTGGTAACTTTAGCAGGT
CAGTTCAAAAGCGCACCAGTCCCCAATAGCACGCCGACATGCTACTGGAAAAGCCCGAGGACGTCAAGCACGAGAACTCGTCGGGCACCGGTGCGTGTGG
ATCCTCTTGTCGAGACGCATGCGTAGCTGATGTCGCGTTTGTGGCGCCCTCATTCGCTCTAACTAACGCGTTCTTGTGTGCTGACAACGGCTGATGCCCT
CGCTCTGCAGTGTGCGCCATCTACGGCGTGGACGCGCAcccgacgctgcagctgttcgCGACGGCCGGAGGAGACAACAGCGTCAAGATCTGGTCGCTGC
AGATGCCGCCCGAGGGAGGCATCGCCTcattcgagctgctggccactCTGGCGAACCACCAACAGGCCGTCAACTGCGTGCGCTGGGCGGGCCACGGCCG
CTACTTGGCCTCGGGATCGGACGAccagctggtgctgctctacgagctgcaggcgggCGCCCCAGCCTCCGTCCCCTTCGGCTCCAAAGCGAGGCCCAAC
AAGCAGAACTGGGTGCGCTGCGCCACGCTCGAGAGACACACGATGGGTGAGACGAGgcttctctctctctctctggCTGCGGAGGTTGGCTGGTTCTAAT
AGTGCTGGTGTGTGTGCAGATGTGGCAGACGTGGCCTGGTCGCCGGACGACCGCATGCTGGCCAcctgcagcatcgacaacaCCATTTTGATCTGGGATG
TGGGTGCTGGGGGACTCAGTGAAGTCATGACGCAGCCGCTGCAAACGCTGACGGGGCACAATGGTTGGGTCAAGGGCGTTGCGTGGGATCCTGTCGGCAA
GGTATTTTTTTTTGGTTTTTCCATTACAGCGTGACAAATGCCAATCGAGTAGTGTCTCTGACGGACGTTTGCTGCTTTGTGCTGCAGTATCTGTCGAGTG
CTGGAGAGGACAAGACGGTGCGGATGTGGAAAGTGGCCGATTGGCAGGAGTCCGACGTTGTGACGGAGCCGTTTGAGGGTTGTGCTTCCACATCGCACTT
CCGTCGGTTGTCATGGTCTCCTGACGGCTCTGTCCTCTGTGCTACACACGCTTTCAGCTCCAAGAAAAATATCGCAGCACTATTAAACCGCGGATCCTGG
ACAAACGACCTTAAATTTGTCGGTCACCAGAGTGTTGTGACCAGTGCTCGGTTCAATCCCAAGCTGCTTGGTACGTCGATGAAATGGTATTGAAATGCCA
TTACACCCATGCTAATAATTTTGTGTTTCATCTATTTGCTCTGCAGTGACTAAGGCAGACCCAGATAAGGAATTTGCATGCTGTGCAGTGGGTGGTGAGG
ACGCGACTGTAAGCATCTGGTTGGCTCATTTAGCACGTCCACTGGCGGTCATTAAGGATTGCTTTGACTCGTCCGTGACGGACCTAACCTGGTCCAGTTC
CCAGTCACTCCTCCTCGCTTGCTCGCTCGACGGCTCCGTCTGCTGCTTTCAGTTTGGGGGGGATGAGATTGGCACTCCAATTTCTGATGCACAGCAGAGT
AAGCTTCTCCAGGCAAAGGTACGTTGCTCGCAACCTACTTCTTGAAGGCGGTTTTAGTCAATAAGGCCTAACATTTAATGTTTCTTGAATGCTTGGAATT
GTCTGAAGTATGGATCCCGGGCCGGCATTACGCTTGCATCGACATTGGTGGAGAACCCAATCCAGCTTCAGGTACgcttgctacatgtagtcccACGTGC
CAGTTGGTATGGGACGAGGTTAGTTATTCACCGAATACATCTTGCTGCGTGTAGCTTGAAGAAAAGTCGACGACTTCACCACGGTTGGCTATCAGTCGGA
GTTCTGGCACCAGTGCTGCTCCCATGGCGACCCACACAACAAATACACTCAtcccgaagaagaaaaagaagctAGGTACTACGGCATTCAGTACGCCACA
AAGCAGACCACCAAGCGGAGCAAGCGACAACGATAAAAAGCGATTCGCTCCTGTACTACTTCAAACGGACGCGCAGCTTTTAGCCAACAACCCAGCCTCA
TCGCAGAACAATATTCGCAACATCTTGGGCCCGACGGTCATATCGCCGACGGCGTCGGACGTCACACTCCTGGATACTCGCATGGCGTCAACGAGTGGGA
AGGAGGTTAGTGTTGCCCCTGAGGCCAATAATTCTGCTACGCTCAAGTCGAACTCTGCGCCGAGTCATAGTGATAAGAGTGGGCCAACCCCCAAGGAGaa
gcctgctgcagcaacgacgactgACGCACCGTCTAAATCGGTGAAGATagagctgaagaagaacgggGTCGATGGGACTTCTTTGAAGAGAAAGCGAGAA
AGTGAACGACCTCCAACTCAAACCGCCGCCGTGGTAGCAAAGTCAAGAGAGGTTGTCGCGCGAGCGCCGAAACTACTGAACGAAAGGTTGGTTCGCCTAA
TGCACATCATTAATGATGTTTTAACTACTGACTGATGGTGCGTTGTATTTTGTGCGGTGAGAGCAGTAGTGGTGGTGTGGCCAGTGGGGGTCAGTTGTTA
CCTGAATTTCCTTTCCGGCTGCTGTTCTCCGTAGAAATAGACACGAGTACACAgtccagcacttcaagctcaagcttGAATGGCAACACAAGAAGCGGGT
TGGTGTCTTCTAAAGTGGTGGTAGAAGTTACCGTTCATAACCTGAAGAACCCTCAGCCAGAGGAAATCATAGGTGAGCTGTGGACGATGGAGTCGTCTTG
TTCGCTTTACACGAATGATCGCTGATGCTCTTGATCAATTGGATGCTCCACAGAGTTAGGTCCAGTTTATTCAACGGTTAAATGCTCCGAGGGAAGCGAG
ATCAAGTGGATCGATCGAGTCCCTGGTCGAGCCGTTTGCGCAGTGGGAAACGCGAGCTATTGTGCAGTTGGTGTTCACAACGGCGACCTCCTGGTTCTCA
ATAGCAATGGACGACGCTTGTTTCCGTGCATTGGTGCGTTTGCGAGCCTATACAATTTGGTTGCTCATAGACTGACATTTGCCACGTTGCTCTTTGCTAG
CTTTGGGCAGTGCTATCTCAGTAATGGAGTGCAGTATGAGTGAGTCGCCCTATTTGTTGGTGATCCTGGCGACAGGCGAACTAAAAATCTGGGACCTAGC
TGAGCGCAAGCTCGTTCTCTCAAGCTCAATCGAGGCAATTACAACTGTGAGTTTTCCCTTTGTGATTTCATTAGGATGGCGCTTTGTTTCTGAGTTTTCT
TCGTGCCGAATGTGGGTATCATAGATCACACCAGAAGATCATCACAAGCTGACTCTTCTTCGGTGCCAAATTACAACGAAGGGAATGCCGCTTATCACGT
TTGCCGAGTCGAACTCCGAAACGAAAGGCAGTTCTAGCCTGTTGTCATACACATTCGACACAGCGATGTCCTCCTGGTACGAATTTCTCTTATGAAATCC
GACGAGAAGTGCGCGACTAACGCATGTAAGAGCGAGATGCTAACCTCACTTTTATGCTTTTATTTTTAAAGGATGCGAGTGGCGGACGACAGCTTTGTGT
TCTCGGACTTTGCATCTGCTCTCCCGACAGATGCGGTGACAGTTAAAAGCGTCCCCGTACGCGTGCGTTTCACCTATTGTCGTTGCTGACCAGATACTAA
TTACTGGAGTTCTTCGACTTTGCATTGTGTACAATAGATTGGTCCATTGCGGCGGCTCCAAAATGCCTCTGGCTATGGCCGAACCCAGAGAGGAGTCGCT
TCAGCCATGCTCTCCGGGATGTCTGACCCGCTGATGCAGCGCAATGTGACGCGCTCGCACCTCGAGCACCAGGTCGCCGCTGCGATCGTGCTGAAAAGCT
CGACTGAATATCGCTACTGGTACGTTTCGATCACCGTGACCAAGATGATACAtagtgttgctgctgctgatttCCTTTACTTCGTCTTGATCAACAGGAT
ACAGGCGTATGCGAGGTTCCTGACgcacgacgaagacgtgcCTCGCTTGGATGACCTGTGCGCTGAAATGATGGGCCCCTTCCACGCGTAAGTTTGTGTT
ACCGGCTAACGTTGTTGATATAGAGAACCCTAAGCGTAATGCCTactctgctgcagatcgtcaacttcaagcACAGACAATGGCAAGAACCCCAAACTAG
ATGAGGGCGGCGAGTGGGATCCAATGGTCCTGGTACGTGGCTCTGTACATATTTCATTTGCAATGACCAACTCGTCATTGTGGTGCTTTTGGGACTGACG
CCCTGAATTGACAACAGGACCTCGTTAAACGGGACGTGTTGAAGTCACACATCCTGCCGACGATTGCGGCGAACCGCGCGTTGCAGCGCGTGGTGACGAA
GTACCAGCTCATGCTGAGCGAGATCGAGGCCcgcgagaaggacgacgaagacga