Description :
From Genome Similarity Track
Location :
contig_141:49660- 51109
Transcript NameFunction/comments
g14281.t1hypothetical protein
g14282.t1hypothetical protein

Sequence
1449 bases(100 bases per row)
GCATGGCCGTCTCCGCATTCCCCACATTCCTCGCTGTCTCCTCTTGTTTCTGTCCGCTTTTCACCTCGAAAACCAACGGCAGCAGCGTCTCGATCTCCTT
CATCAAGTCTCCCAGGTCCGTGCGCTTCACCGCCAGATCGTGTCGCAGCTGACGCACCCTGTGAACGTCGATATCCGCGCGCGGGAAGCCCTCACTGTCC
ACCAGCGGTCCGCGCAGCCCCGGGTTGTTCCCAGACGTCAACTCGGCAGCCAGCGCCTCCATCTCCGCCTCCAACGTGTGCTTGGCCGCCTCAGCGCGCG
CGTATCGATCCAAAACGTCCATTTTGGGAAATGAGCGCTTCTCATTCGCTTAAAGTTAGTTTCCACCAATCACATGACCTTCTTCGCCTGCTACCTGCTG
ACGCCCGTGCAGGCGCCGCAGCGACTCCGCTGCACGTACGTGGGCTTCACGGTCGCTCCTGCAAGGCGCATCCGGCAGCATAACGGCGAGCTGGCGGCGG
GGGCCAAGCGTACACGCAAGAACCGACCATGGTAGGTGAATACGTATTTAATATTATATTCATATTAAAAAATACTAGTCACAATGTATTAAATCTCATG
TGAAATGCTATAGGGAAATGGTGGCCGTAGTGCACGGATTCCCCAGCAAGTTCCGCGCGCTGCAGTTCGAGTGGGTCTGGCAGCATCCATCGGTGAGTAA
ACTCACTAGGAACCAGCTTGAGTTCCTGCGAGGCTCGAGAGGACTGGGGGCTCCACGGTCGGTCAAGAGGAAGGTGGTGGAGATGCTGGAGATGGTCAAC
CTGGACCCATGGAAGACGCTGAACCTCACCGTGAGCTTCACGACGGACGAGGTGCACGACATTGCGAGGACGCTGGGGGGGCAGATACAGCGCTGCAAAG
TGCGACACGAGAGCGTTGATCACTTTTGCTGACGTCACTTCAACTTGCAATTGTTTCGTTTGTGAGTCCACAGTAGAGGACAGTTTGGATGACGCGGTGG
GGTGTTATCATGACGGGTGCGACATGTGCTGCCATCCCGAGTGTTTGGTGGACCATTTTCGGTCCATGAGAGACTCGGAGGAGGACGAAGAGACGAGTGG
AGAGTGTCCGCAATGTCAGCAGGTTCTTAAGTGCCGTTTGCTGACGAAATATCATGGGGAGAAGAAGAATCGGAAGAGACGACGTGGTGGACGCAGAAAA
GGCGAGAAAAGAGTGCGCGTGGCAACTGCACAAGGGACGAATGATGAAGAAACACACCCTCTGCGTGTTGTGGAGCAAGGCCCAACTCCAGATGATAGTA
GGCAAAAAAGATGCGACGGAGAGGGAGTGGATGCGATTATCATCGGGTCGCCGCCTTCTTCAGGAAGTTTTGCGGCTGAGTACAATTCGGATGGCTGGTT
TGAAGACGATGGGATTTACGCTAACGATGGTGGTGCAGGCTGCAAGGAC