Description :
From Genome Similarity Track
Location :
Scaffold_531:4966- 7885
Transcript NameFunction/comments
Phyag_g6424serine protease family S33, putative
Phyag_g6425hypothetical protein

Sequence
2919 bases(100 bases per row)
GTCGCCGAGCGAACGAGATCCAGCATGCAACCCCGTTTTATCCGACATGGAAAGCTCTGGTGCCCCAAACTTTACTCAGAGCTTCACGTACGCTACGGAC
GAGTTTTACAACAAGACTGCGTCTGTCCCCCCAAATGCTAGCTTGTTGTTAATTAACGGAGGCCTGGACTTCCAAACTCCATTGGAATTTGGTCGGCACC
AATTTGAGTCGACATCGCTACGCGATCCTGAAACGAGTCGTAAAATGCTGGTCGAGTTTGATTTTGGGGGTCATGTCTGTGGTCTCTCTGCTACAACTAC
AGACGACGAGACAATGTGTGCACCTGGTATTGTGGCGTCTTTCATCTCCAACCGTGGTGATCCCAACGCGATTGATACGTCCTGTATGAATGAATTACCG
GAGTTACAGCTCACGGACGCCGCGTTCTCCGTGCTGGTCCAGTCCCTCATTGAAGCAAAACGCGAGCAAGTGCTAGGAGTCGCAGGTGGCATTGGCGGGT
AACACTTTCAAGCTTCGAGGGGATCTTATCGTTCGAGTTGAAGATACGATCCCCTCAAAGCTTCTACTTTTACCACTAAAATGCAGCGGGGGGTGCTAAT
GCTGCAGTGACGGAATCCTGAAATTGGATTTGATAAATCCAAACCACCAGAGCAGCGTTTACATGCTAGGTGCAAGAGTTTAACTTGCGAAAAAATGAAA
ATGGCGCGGCTTGGAAGAAAGCCCAATTATTATTCCCCAGAGTGTTAGGGTGGATACCTCATGGGTAAGGTTCTCACCGCGAAGAATTTATACAAACTGC
AGACAATTGTATCTAGTTCCAGGCGACAGAAGACTGCGATGCGATCGGTGTTGGCGAGAAATATTGGTGTCGTCACTTATGTACATCGTCTGTGATTTGA
CTGCGTTTTGCAGTGGTGCGACCGAGTGGATTTTTGTGGACATCCCCGCCTTGCTAATGAACACAACACCGCAATCGTGTTCAAGCTTCGCTGGACGTCT
AATGTTTACAATCCGCGTTTGACTCAACAAAGCGAATCTGCGACACCGAGAGAGCTAACACGGAGTTTAAGAGAGGATCTAAGGAGCGCCCAGCTGCAGT
GGGCGCTCCTTAGATCCTCTCGGAGTTTAATCGCCGTCAAATCCCTTATGGCGATCTCCGGTTATCGACCGTCGGACAGCAAAACGTGCTTTCGAATGAA
GGACTTCGGTCGCCTAACTCCCATGACTCGGTCGACTGTACTAACGAAAACCAGCTCTTGAGTCGACCGCTAACAAGTGACTTCAATTTTGTTTCGCTGC
ATTCTGTCGAGTCCAAGCTTCTGTCCATTGTTGATGACAGCGAACCCAATAATAATCGGCATGAGGTTTACGGCGTTGATCCTATCCTCATGATCACAAC
CTGATCAGGAAAATCGACAGGCTTCGAAGGCGATCGAGTGGAACCGGGATGGCTACATCGGACATTTTGGCGTTGCCGTGTCTAACGTTACGCTGTACAA
TCAGCATACCTGATGTTGAAGACAAAGCGATATAGATGCTTGACGGGATCGTAGCATGGCTGGTGAAGCGTGTCGCGCATTGCAATCTCCGCAGAATGGC
AATACAGCAACTCTAATACGACACCATGACAGAAATTGTAGCAATTCTATGGCAAAAGGTAACCACAAAACAGCTGTTCTCTGGAAATCTATTTTTAAAT
TACCGAGACAGGTTGCCTCCGTCACGAGGACATACCGGTAGTTGTCTAAACTTAGAGATATGGTGCGCTACACATATATTTGTGGTACACGTAGATATGG
ACACCACATCATTATACACACACTAGCGCTTCCGATTTTGCGCAAGCCGCGACACGCCATCGTGGTTGGGGGGAGTCTTCTCCAGAAGGTGTGAAATAAC
ACAAAAAGCCGAAGCGACAGGGATCCAGGGGCATTCGACTTGAACAAAGTATACAGGCTACTATTCGAAGCACTACGAACTTCTAGCGGAAGGACGTGGA
GCACGAAATGGCCTGTGACGACGCACCGAGCGACGGCCCACCACAAGCGCCACCAAACCAGGGCGTGGTTCAAGATTTACAACTAGCGCAGAGTGAGGTG
GTTGACTTGACTTCGCCAGCGACCGACCAGAACGCCCATCCAACAAACGAGACGAAACCTATGATTAATGAACCTGAGGGTCTAGCACGCAAAACTACGC
GAGCGAAGTTCATGATCAAAGCGACAGAGGCAGCGAAGCCTCAGGGGAGGGCCCAACCCGATCCGGAACCGAACGAATCGGAGGACGAGTCAATGGGAAC
GTCCGATCCCCCCAGGTACGATGATGCCGAAGCCGAGCAGCTATCCTTTGTCGAAATGTACGAGTATCTGAAGAGTCAATTGAAGGGACTATCAGTTGAA
CAGGCCAAAGAAGATGAAAGCGCAACCGATTTCTTGCAACAGCTCTTTGCAAGCGTGTTTGAGAGTCATGGGGATGGGTGGCTGCCACCTGCTCGACGGC
GCTACCCCGAATTAGACACGGAGGAAACTGATAAAATGCTGCGCTTGTTTATCACGGATCTCAAAGATGAAAAGGCAGACTCACGCAAGTGGAGAGCGCG
ACTCAATTCGATGACAAGAGCCATCTACAAGTCCAGAAGTTCTCTGAGTGAAACGATTGATGTGCTGGAAAAATCGGTCCGAGCCAAACCAGGCCCAATC
GCTAACCCGTGGTCTCAACGTCTTATGGGGCCTGCCGAGGAGGGGCAAGATGAATCGACCaaagcagcggcagctgTGTCCTCTTACAAATTCTTACGTA
GCGCATATACGCCGGAGGAGATAGCAGACCTGCGAGAACTCTGCGAAACCCGTTACGGGTATCCAAGTGTACTGAAGAAgccaacgcagcaagaagaaaa
agtgATTCAAGGACTCGTT