Description :
From Genome Similarity Track
Location :
Scaffold_1363:4966- 7653
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1363-snap-gene-0.5WD repeat and HMG-box DNA binding protein 1

Sequence
2687 bases(100 bases per row)
ATCAAGAGCGTCGTGTTCGACGGCACGGGAAAGCTGCTGTGCAGCGCGAGCGAGGACGGCACGGTGCGCGTGTTTGCGATTGACGAAGCCGCGCTGAGCG
CCACGCAGCTCGCTATGTTCAAGGTTCAGTATGGCGACATTCGCAGTGAGCAGGTGCTCGCACGCTGTGCATGGCAGCCTGGGGATCAGGCAGAGCTGCT
CGCCGTGCCCGTGAACCAAGGCATCGTCGAGCTCTTTGACCGCACGACCTGGGCCAGCAAGGGGCAGCTACTCTTGCCCATGCAAGAGCAAGAGCTCGGA
TCTCAACGTCCTGAGCTTCTCACCGAACGGACTCTACGTAGCCGGCGCGACGCTGCAGCAAGAAGTGTTCATTTGGTCGGTGGCCGACAAGCAGTGCGTA
CGGTCGTTCAAGGTGGACCACGGCGTCGTCGCTGTGCAGTGGGCGCCGTCGCAGAACACGCTGCTCGCGTTCAACGACGGCGGCAAGCTCGGCGTCGTGC
AGGACGCCGTGCCCATGGGGCTCACGCCGCCACACCAGCTCGGACTGGGTGGCAGTAGTACTACTACAGCTACTACAACTACGGTCTCCGCTACAGTGAA
GAAACCCACGCCGTCCAAGAAGGGCGTGACCGGCTCCCAGTTTGTCGACGATGAAGCGATGGACGACGGCGACGGTGGCGACGACGAGAGCGAGGCCGAA
GCCGAGTTGGACGACGGCGAGACCCGCGTGGAGGCCATCAAGGCGAGCTTCGGCTTTGGCGCGGCCACCAGCGGCGACGCCGATCTCGGTCTCACGTCGG
ATCGACTGGAAGGTGATGACGACGGTGACGACTACTCGAGCCATCTTGGCTCTTACGCCAAGACCTCGAGTGCCGTCTCGGCCTCACCCTTTCAGACGTT
CCAGGAGCCGTTCCAGTCGGGCAGCGTCCAGGACGGCGCCGTGACGCTGCTCGCGTGGACGCCGCTAGGTGAGATCGAGTGCGTGCGCTCTGCGAGCCGC
CGCGAGCAGCTCGTCAAGGTCGAGTTTGCCGACAAGTCGCGCCGCGGGTTCAAGTTCAGCGACCAGTACCTCTTCTCGATGGCGGCGCTGGACGACCATG
GCGCCTTCTTTGGCGTGCCACGCCGGGCGCGCGAGGACTGGGACGTGGACGACGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCTCGGGCGTCATCAGCAGCTTCATCTTTTACCGGCCATTTGACTCGTGGGCCTCGAACGCGTTGTGGCACGTGGATCTCCCCGAGGGAGAAGAC
GCCGAGAGCATTGCGTGCGCGCGCGAGTTCTGCGCCGTCGCGACGTCGCTCAACTGCCTCCGTGTGTACACGACCAGCGGCATTGCGTTTGCGCTCGTGC
GGCTGCCCGGCCGCGTCGTCACGCTCACGGCGCGCGGCTCGAGACTCGCGGTCGTATACCAGGACGGAGTGGCGCGACTCGGGTTCAAACTGCTCGAGAT
CCACGTGTCGTCGAGTGCCGACCGCGTGCGTGTGCTTGCTGACGGCGTCGTGCCGCTCATGCCGCCGATCGTCGACGTGTTTGGAAGCCACAAGGAAAAC
GAGCAGCGCCGTCGCGACGTCGCCAACTACGCGACGCTCGCATGGCTCGGTTTTGACGAGCGCGGCGTGCTGATTGCTGTCGACTCGGTCGGCTGCGTGC
AGGCACTCGCGAGCAGCTACGGATACCAGTGGTTCCCCGTCGGCTGCGTGGGCAATGCGTTGCTCAAGAAGCCCGACGCACGCCAGGCCGTGTTCACGCT
GGGCGTCGTGAACAATGCACTGCTCTACTTTCCGCTCGAGCGAGGCCAGACGGCGCCTAAGCTGCGCGGCAAGCACCGCCCCGTGCCGCTCAAGTTTCCA
CTCCAGCACGCGGCGTTCCCCAAGACCACGTCGTCTGCCTCGAGTGGCAAGAAGGGGGAGTCCCAGGGCCCCGTCGTGAACGACCTGTGGCAGCACGTGC
GGCTCGCGGCGATCGACGCTCANNNNNNNNNNNNNNNNNGACGACGACAAGCGCGTGGCCGAGCAGGCCGAGATGGACAAGTCGCTCATCCTCATGATGA
AGGCCGCGTGCACCAACGACGAGCCAGCCCGCGTGCTTGACCTGGCCAAGTGTCTCCACCTGGAAAAGTCGCACCAGATCGCCCAGAAACTCGCGGGCCA
TTTCGGGTTCCGCGAGCTGCAAACGCAGCTCTACGAGCTGTACCGCCACCAATTTGAGCGTGTGGATCCGATGGAGCTGGACAGGTCCCATGAGCAGCTA
CCGTCCAGACGCTATGCCTCTTCTTCGTCTTCTCTTATGCACCGGTCGTCGACGGCTGAGCCGCTGGCGCACAGTATGGCCTCGCGTCCAAAGCCTCGCC
TGGGACGCCAGCCCAAGCCAGCTCCAGAAGAAGCTCTCCCAAAAGAAGAAGTCAAGGGCGACGATGGTGACGATGAGGTGCCTCCTGCTGCATTGTCATC
GTCTGTACCCGAGAAAGAGAACCACCACAGTGCCAAGCCTCCGTCCGTGGAGCGGTCCGTGGCGCCCGTGAACCCGTTCCTGAAAAAGCCATCGCCAACG
TCCTCTTCCAACTCTACCACCAAGTCCAAGGCGAGTGGCGGCGGCCTCGAGCGGCTCGCCAACTTCACCTCGCCGCCGCCAGCCAAG