Description :
From Genome Similarity Track
Location :
Scaffold_144:49651- 54765
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14946Hypothetical protein
Sappa_CBS223.65SPRG_14947bifunctional folD protein putative
Sappa_CBS223.65SPRG_14948Hypothetical protein

Sequence
5114 bases(100 bases per row)
GTGATCGACTAACTAGAGCTCTAGGACGGCGAGAGCTCGGCGCTCTACTATTGCATTGCTTGCATTGAAGACGAAACCACGCGCGTCGGACACGTCTTGG
AGCTCCTCGAGCGCGGCGCCAGCAGCGACATCAGCAAGGTAGTGTGTTGAAACCGATAAACGAGGTCTCATTGCCAAGGATGTTGTAGGGCGATGTGTCG
CCACTGACGTACGCCGAAGACGCCGACATGTTTCGATTGTGGAGATTCTCCACGCGTACCTCGAGGCGGCCGTAAGACTCCGCTTGGCGAAGTTTCTCTC
GGGCTCTTACTGTCTTTCGTCTAGGAAACCGCATGGTTTGACCATCCTCGCGATGCGTCGCACCCGGCAGACGTCGCCACTGAGCCGAGCATGACAAGCG
CCCGCTTTAATGCTCATGTTGAGGCGCACGGTCCCAATGCGCAGGGCAACTGCGGTGCCGACGATGATTGCGATGACGATGGGTGGGAGGTCGTGGAGCC
TCTTCAATTGTCCTAGGACTTGTAGTCACGCGGACTGCACGGCTTTCTTTCTCGTCTAGCTCGACAACTCTGCGATGGCTACTACTGTGTGAATAGGTAG
AGTCAATGGTAATAGTAAAAAGGGAATGTATCAGAGAGCTTAGTATCGTCAAAATGTGCAACATAATCAGACGGCACTTCCAAATGTAAGCATTAGGTCT
ATCATTTTCATTCCCCTTGCTAGACTACAATCTAGATTCAGTGATTCGTGTGGCCCTCGTCAGGATAAATATCCTCCTGTGTTTCAGAGTAATTCTAGAG
ATAATGGCAGTCATCGGGCGCGTTCTACTCGTCGACTAGTCTACGACACCTGCAAATCTCAACTGATCGCATTCCAAAATGACCGGCCGACCTGAAGGCT
TCCGCACCAACCTTTTTCCAGCCAATCATCGTGCGACCTGCCTATCAACTTCGACCGTTGGCCTCTAAACTTCGCTTTCTAGCTTCGATATACTCGCCAC
ACATGATAATATTGGATGATAGAGGTCAAGTGTGTTTTCGGCATATGCCACTTTAAAGACGGCGAGCGGGAAATAGGGTCGCTGCCCATTGCCGTCGTCA
GTACTGCGAGATGCAGACGTCTGTGCGCAAGACACTTCCATAAGGCTCCTTGCATTTCGATCGATTGCACGACGGTTGCATGGGACAACCTTGCCGTTCC
CTGGCCACCGTACGCCCAATATGCCGCATTTAAACCCTACAATGCCGAATTGGACGCGAAACTGCGCGAAGATTCGCAAACACCAGTGAAGATGGGCGTG
GCGACGCGGGTCATCCAAGGCGCGCAGATCGCCTCCAAGATGCGTGCGCAGGTCAAGGCCAAGGTAGACGCATGCCATGTCCATCGTCTAAGCACCTCTG
TAGATTGATGCCATCGCGGCGACGACGGCTGCGGTACCAGCCATGCTTGCGTCGCTCCTGCTCATCATGCTGGACTATGTAGCGGCCATCGCTCGGTGTG
ATCATGGTTGGCGACCGGAAGGACTCGCGCTTGTACGTCGAGGCCAAGGGACGCGCGTGCCTTGAGGTTGGCATCACGTCTGTGAACCGGTTCTTCCCCA
TGGACGTTGCCCAAGTACGTTGATCCACTTGCCATCGTCATCCTCATGGCTTGTCTAGGCGGACCTCTTGAACCAAATCGCTGCGTTTAACGCCGACGCG
TCCATCGATGGCATCTTGGTGCAGGTGTGTCTCTCGACGTCATCCATGGGAGACGACCTCATAGTACGTAGCTGCCGCTGCCGCCGACGATCGACGAGAA
GGCTGTCATCGATGCCGTCTTGCCGACGAAAGACGTCGATGGGCTGCATCCGTTCAACGTCGGTGAGCTCTCGATGCGCGGGCGCACGCCGCACTTTACT
GCGTGCACACCCGAGGGCGTTCTTCAGCTGCTGGACGAGGTCGGTGTTTTAACGTTGTGCAGCCCCTCATTAACGCCGTAGGAGGGCATTGAGCTACAAG
GCAAGGTCGTCGTTGTGCTGGGGCGTAGCGACTTGGTCGGCAACCCCGTGGGCATGCTCTTGCGCAAGCGCCACGCGACGGTCATCTCGTGCCACTCCCG
CACTGGCAACGTACCTTCTGCCCATCGATGATGGAGGCGTGTCGACGGCTCATGCGACCGTAGATTCCAATGTTCGTTGGGATGGCCGATATTGTCATTA
GCGCCTGCGGAGTCCCGCGCCTTGTTCGCGGGAGCTGGCTCAAGCCTGGCGCGGTCGTCATCGACGTTGGCATCAACTTTGTCTCGGACGGCGGTGCGTC
CTCGGTCGTCGGCGACGTGTGCTTTGACGAAGCCATGGGCGTGGCTGGCGCGATTACGCCTGTGCCTGGCGGTGCGCCTCGCCCACATTATTAAACGTGT
TTAAACGCATTCTCGACGTAGGGGTCGGGCCCATGACGATCGCGATGCTCATGCGCAACGTCAGCGTCGCGTTCGAGCGCCGAATAAACTCCGCGGGCCA
GCACGTTTAAACACACAACAACGAAACGGGTTTTTCGAGGTCTCCAATCGGTTTCATGCAAGCATGGAGCCGCACTTTCCCACGACATCGCTTCCGCGCG
TCTTCCGCGAGAGCTTGGCCAAAGCCACCGAGGTCCGCGAGCCGCTTCGGCCGTCCCTCCCTCGGCACGCGTAGGCTGCATTCTTTGGAGATGTCAAGTT
TCGAGGGCGTGTTTCTAGAGCCACGGCCAGCTCGACGCACCGCCGGCTGCCTCCCAACCCGTCGCCTTTGGTCCAGCCAAGAGCGTTTGAAGCTCCGTTT
GGCACACATCGTGGTGGTGCCAAGCCCAAGCCGCCGGTGACAACCAGCATCGACCCGCGGGACGAGGCCGGCATTCTATTCCCGTACAACAACATTGCCG
ACGACGATGGGTCTCTCCAGCAAATCATGTGGGCCAAGTGGACCCACGACGACCCGAGCGACACGGATTCCCACGGGGCGCGAACCAAGGACGCGTTTGT
CTCGTTTGCCTTGTAGGCTCCATCGACAATGTTGGTTCGAATACTTTTGTTCGTGGTGATAGATATGCCCAAGTCAAGCTCCAAGAGGCGCAGCGCATGG
CCGCGTACTTGGAGCAGCCCAACCTCTTTGTGACGGCGGTCGCGAGCTCGCTTCTCCAGCGGGTATCTCGACGTGTGGATATCGATATTTGCTAAAAACG
GGTCGTAGTGCGCAGACCGGCTCGGGGCGTCTGGCGGCATCATCCACCAGCTCCTACAAGTGCTTCTTTCGGCTATCTACCACCGCAAGGACGCAGATGT
GACGCCGGCGCGCCTCAACGTGGACCGCTATGCGCCTTACTTTGCCGTACGTCTCCAGAATCCGCGACAGTATCAAGAAGACAAGGGTGTAGGAATACCG
CCGACTGCGCCGGACGTGCGTCGACCTTCTCGAAGAAAATACGCGCAAGCACAACGAGACAGCGGCGCGCAAGCAAGGGTTCGGCAAGATCCAACGCGTC
ATCCAGGGCACGACGCGCATCTGGAAGCATCGGTTGTTGCACTTTCTATACTTTCAGTGGGCCTACTATGTCTTCCGGCGGCGGCGCATTCGACGCGTAC
ACCTGTCTGATTACTTAGTTGCAAGCACATGATTGTCGTCTAGTTTGTGGACCGGACGTTTCGACACAAGAACCGCGGGCCCGTGCGCGACACCTTTCGC
GCGTGGCGCATCGAGGCACTCCGCCGCGCCTACTATGTACGCCGACCGGTTGGTGCGACAACTCATGTACGCTGCGTAGCGCGAGTCGGCCAACTACCAG
ACAATGTTGTCTGTCACCGCCGAGTCGCTCAGCCGCAAGGTGGCTGCTTCCTTGTATCAATGAGAGAGATCGTATGTGTGTGGGTTGTTATAGGACGTAC
AACTGACGAGCGCCACGGAAAAGATCGCCAAGCTACAAATGCACGTCGATCAGCTCACAACCACCAACTCCAACTTGGTACATCATGCGGACAAGCTGCT
TCCTGGGCTGGAAACGCGATGGTAGATCACGCGGGTCCAGGACCTCGAGAGCCAAATTCGCATCTTGAAGCTCACGATGCGGGGCAGTCTGACAGCGCCA
GCGCAAGACCATCCACCGCTTCTTTCGGCCATGACGGCACCGCCCGCGGCATACGAGCGCATGGACACGATTGTGTACGAGGACGAGCAGCCGCGGGACG
ACGGCGGCGGCGGGCGCGTCAACAAGATGCTTCTCGAAGGCATGTTTGCGATGGCGCGCATGGTCGAGTCGTCCGTGATTCAGTTTAGCAAAGAGTCGCT
CGAGGCGCTCGAGACGCAGTACGATGGCGCCGAGTTGCGCCAGCTCTCCCGGCGTGTACACATTGTCTTTTTTCAAGAAGACACAAACGTAGTGGTAGAT
TGCCGAGGAACACGCGCAGATCGACAAGATCACGACGGGGTACCACGACGTGCACTTGACCAACGTCCTGAGCAAGCCGGTCGACACGATCTTGCTGCAT
TGGGCGCGCATGAAGCTCGAGGAGAGCAAGATTGTGCTGCGACCGCAAGACCGAATGGTAGACAACTTGTCCACTTTTGCACACCATGGTCGATCGATGG
CGTAGCTGAAAAACTTTACCGACGACTTGGCCGACGGCAGTAAATTCTCGACGCTCTTGCACCACTTGTTTCCGCTCGACTACGACACCCACGTACATCG
ATGTTGGACAAAGATTGTCCATGCTCAACGCGAGGCTAGATGGTGCACGAAATCGATGTCGAGCAGCGATTGGCCAACATTGAGCGCTTCAACAAATCGC
TGCGCGTCGAGTCTTCGAGCGACGTCAAAATCCCCGCTATTGTCACCGCCGACTCGATCGCGGCCCAGCGCGGTCTTGAAAACGCCGTCTTTATCAGCGT
CCTCTTCACCCTCTCACCGTTCGTTCTTATATATTCTTCGTTGCAAACTTATGGCAACTGTTGTAGCGGACACTTTTCCAAGGTCAACACGGAGAAGTGC
CGCAAGGTGTTTCTCCAAATCGTCTCGGCGTGGAAAAAGGTGTGTGCGTTGCGGACAACTTGTCTCTTTGAAAGCAGACGTGCTAGGTGCGGAGCTTGAT
GCTCGAGGTGAAGC