Description :
From Genome Similarity Track
Location :
Scaffold_1900:4965- 6247
Sequence
1282 bases(100 bases per row)
AGATTATACTACACCTCAGCGAATCTCCACGTTGTTCTTCCACTCTAACGCCCCCCCAGAAATCGTAATGTAGTGATGCCAAACTTCTTTGCTTTCTTTC
CGCTCGATTTCTGCTATCATTTGTGCAGACAAGTGATGAGGCGGCTCCCACGTTAGCTTTTCCTAGCTCCTTACCATGACTCTAATGATTACTAACATGT
TAGTTCGAAACACTAGACACTAACATAGGCTTAATTGTATTATCTACAGCTACTTTCAATGCTGCAATAATTGTTGCGTCAGCCAAGCTCCACGCTCCAC
GGTATTCGATTTCACTCAGTATCATTTAGAAAATGCGGTTCATACAGCCCATGTTTTCACATGGACAAACATGGCCTAAGAGCCTGAAAACATGGGAAAA
CATGGGAAAATAGCCATGTTTTCTTATGTTTCACTAGCCGATTTGTAAACCCACCCCTATCGTTTTAAGTACGAAGCAAATCCATATTTGGGGTCTCGAA
AAACTTGTTGAAGACCTAGCGATTGATAGCATAGGTGTACGAACATAATCATACCCTCCTCGTACAGCCCGCGGTTGGTCTGAAAGATAACGTATTTGGA
CTTTCCGATTAAGGCGTTGTAGCAGCATGAGGAGGTTCAAAATACGAGATTTGGATCTTTTATGCAAGAAAGGAGCCAATCAAAATGCAGGATTGAAAAC
ATGGTAGATTTCCCGTTTAGAAAATATGGAACTTCAAAAAAATATACTCCCTCCGTTTCACATTACTTGGCAGATGCGAGTAAATGTTGTCGGCTATCGT
ATCCTACCAAGGTAACAAATATTGTAACATAACTCGAGACACCAGCGTTCTCAGCTACAGTACACGGACGGTTGTGTTGGATGAGCTGGGCTTTTAACCC
CCGAGCACGAGTGTTTGCCAGTTTGTCGATGGACCATGTGGATTGAATTTGCACTGGGGCAACGTACTAATCGCGAAGGATGCATGACAACGAAACAGGT
AATAAACATAGCAAATCAACGAATCCATACAAACAAACTGAATATCGGTAACAGATTGTACTGACGCAAATTATCCTTTTCAGATCGACTGAGCAGAACG
GCATGTACTAAAGGTCGAGGCCTCCGAGACTATGATATATtagtagtaatacttagaacattacgccggcagtttttttccttaccgtaatttactACCA
AGAAAATTCCTGGAACCTTCTTTCGGGCCAGCTGcaatttcgacgacgcaacctctcgaccacctgagagcgaaaCCAACGC