Description :
From Genome Similarity Track
Location :
contig_7:49643- 50648
Transcript NameFunction/comments
g2463.t1hypothetical protein

Sequence
1005 bases(100 bases per row)
GTGTACATGCGCGCACGTCTTGCACTTTTTCGAGAAAGCCTTGGCAACGAACTGTTCGCATCGGCAAGAGCTGCATGGCCCTTGGGCAGCAGCAGCAGCA
GCAGTCGATGGACGGCGTTGAGATCCACCAGTCGATTCAAACTGGGCGATGCCATCCATGGCTTTGTCGAGGGCATCGTACAAGGGCTTTGCGGCACGGG
GATGCGGGACTGTTCCACTCAAAATCTCCTCCGGTGTGAGTTTCTGGCCGTAGAAGTTGCTGTTCATTTCTGTCCGCGCCGTGATGACAGCACCATGCAG
CGAAATGCCCGCAAAAAGGCCACGACTGTGCGAGTAGCTGTAGTTAGCGTTGAACCCACCTCGGCTAGCAGCTGCTTGTGCCAGCGCGTCGCGTCCGTAA
GGGCCCACCGCCACGCTCAATCCTCCTCCCACGTTAACTTGTGTTCGGTGGAACACCTTGACGGCGTTCTTGGAGCCCATAATAATCATAAACTCGATGA
GCTCGCCACCACCCTCGAGGCCACCGCCAATACCCGCAGTACCGATGGCAGCAGGCGCAGACCAGGAGCCATCATCCAGCTTGGCAATCACAATACCCGT
ACCTATCTTGGCTGTAATAAGCAGTCCCGCTTTGATAACTGTGAGGAAGGCGATACCTTGCGCTCGCTTGAGGAAATTGACAGGGATATAGCGGTCGCTA
TCAGCGCCAAAGTCTGGACGGAAAAAGTTACCGAGAATGTCGGCTGCGGAGCGGCACGCGCTCTCCAAGGACCGACTGTACGGTAGATGCAGTCGCGTCT
TGGCTTCGTGTGGGTTCTCCTTGTGACAATTCGCATACTGCGAATTCAGCCCGTCTTGGAAGCACTGCAGGATGGGCGCGCAGATGGTGCAGACACGTTG
CGGGTGTGCGGGGTCGTACTTCTTCCTCATGCTCTCACTCGCCACTTGGTCGGGCGAGATGAGCATCCTCGCAGGAGAGCACGAGTGGCACACGCTCGCT
CCGCA