Description :
From Genome Similarity Track
Location :
Scaffold_89:4964- 6881
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_89-abinit-gene-0.70Protein claret segregational
Pytve_DAOMBR484maker-pve_contig_89-fgenesh-gene-0.12Gene of unknown function

Sequence
1917 bases(100 bases per row)
TCCTCGGGATTTGATGCTGGCAGATGGAATCAGCGTATTCGTAAGCCCAACACCACAACACACGTTCATTTCCTCCTTTTGGCACACCTGACGAAGGAAC
CAGTCGGTGCCGCTCGAGGTTTGGTACGAGATGGGACGACCTGTCTTCTTGAGGAAGCTGTGGCACAGCAAGCATAGATGAATCAATGCTAGGGGTAAGA
TGTTTCTGACGACGAGATGCCTCACTCTCGCGCGAGGTCTCGAACGCGATCGCAGTAGATTTCGAGGAAGCTCACAACGAGTGTGACTTCCTGGAGGTGC
AAAGAGCCACCATCTGAGCAAGTAACTCGGCTTCAAATGCACAGGTGAGCCGTACCTTGGCTTTGGCCTCGTAGCGATCGACCATGTCGAACAGGTACTC
AATTGATCGCGAGAGTAGCCCAGTCTTTTCACCGTGCTCCCCGAAGATGCTACCCACCAGGATCGTTAGCCACTTCGCGACAACAGATCCAGCGTGTCTG
AGAGTCGTGGCATAACATGACAATCCACCTGAACGTTTTGCCCGATCCGGTTTGCCCGTACGCAAAGCAGCAACTATTAATGCCTTTCAGCGCATAATCG
ACGAGGACCTTGCTCGACTGAATAATCAACCAAATTGAATCGTCATGCGTCGTGGCAGTGCTCACAGGCAAACGAAACGAGAACTGGTGCTAACCGACTC
GAACAGCGTCGACTGAGACGTATCGGTCCAGTAAATCTGCTCCACCAGCCAGCCGAATATCAATGCGTTACCCTCCTCCTCTTGGTTGCCCTTACAAAAA
CTCACATTGTCGAAGCTGAAGGCGTGGTTTCCGTACTGCATCCGCTCCGTGTCCTATTCGCCAAACTCTCGCGTGAGGAAAGACAGTCCATGTTCACGCC
TCTGAGCGACAACATTCACCTTGATGACGATGTTCTTGGGCGTCTCCTTCTTGCGCTCAAACATGTCTTCGGATGGCGGCTGTCCGTCGGCGCATGGTCG
AGCTCGCACGAACACCTGATGAAAGTGAGCTCAGCTCCGCTCGGAGGGTCAAACATCTACCTGTTAAGAGCCACCTGCCTTGACATTGGCGTTGCCGAGC
GACCGCGTGTAGTCGGTGGTCACTTTGTGGTCCATGGCGGCGAGGACGTCGCCAACCGAGCTGGTGACGCTCGCGACGTTTGAACAGCCTTCTCTGTCTC
CTGTGATGTACTGTTGTCAACCGGAAATAGTGCTCGCTGCTTGACGAAACGGGTCACGGCTGAACGGCCAAGACCAACGGCACAAGATATGTTGTTGCTG
CTGTTGTTTGTCGAAATTGCTTACGCACACAATGATATTGATACACACGTACACTCGGCTCGTCCTCACATGCATCGAGCCACCTCACTCTCTCTCTCAC
TTTCTCTCTCTTTCGCCCGCGCTGTCGGCGGCGAGTCGTACCCTCCCTCCTCTTCTGGTCTGTCCTGCAGGCCCTCGTCGATTCGGGGCCGGGTGATGGG
AGCGCGAGCAGCACACAGTGCTGGCCGCTCGGTCGCTCCGGAGCTGGTTTAAATATTGGGTATGCCGAGGCTCTCGCCGACCGCTACAGCACGATCGTCT
CCTTGTTCTTGCGGTACGGACCGCTGTGGCGGCGGAAGTTGCCGTAGTGCGAGTGGGTCGACACGAGCAGGCTCTTGTTGAGATCGGACGTCCCCTTGGC
GTACGACAGGATCTGCGGCGAGTTGCGGTGCAGCCGCGGCTTGGAGCCCAGCGGCGTGTGCTGCTCCGGGCTCGGCGTGGCCGCCTTGACGTACGACGCG
GCCTTGTTGAGTCCCTTGGCGATATTGGCGACTGCCGACGGTCGACGCGGCCGGGGGACCGACATGGTGCGCGCGCGGAAGAGCGAGTTGCCGATGGCGG
TCGAGAGCTTGCGCTGT