Description :
From Genome Similarity Track
Location :
Scaffold_652:4964- 6370
Transcript NameFunction/comments
Phyta_totarag9949hypothetical protein

Sequence
1406 bases(100 bases per row)
CTCTCCGTCTGTAAGCCCTGTACGAGCATACTGCAagtccagctccagatcgTCGTATCTGCACCTTAGTTCACGCTTCTCAGCTTCCAGCTCTCCATTT
AGCCGTAGTAGCTCCGAGATGCGAGCTTGGATCGCTTCCAGCTGACGCATGAGGTCTTCATTGAGTGTCTTTGTTTCACGAAGCTCTGCTTGCAACCGCA
TTTCTTTATCCTTCCACCCCGTTGCCTTTGCAGCAGCCTCAAGCTGACTCATGAGCAAACGTTCTCGAGTTTCTAACGCATCCACTCGGCTCTTTAGCCG
GCCTACCTCGCTTTGATTACCTCGTTGTTGTCTTAGGTCAAGCAGTGGTAGTTGCGCCTGTTTGTCCTCCAAGTCTTTCTCCAGTTGTTtacggcgctgc
tgctcgacctGTATTTCATTTTCAAGCGCATCTAAACGTTTCCGGAAAGCCTCCCACTTCGTATTCCGAGCTGTCCAGTCGCGATCCTTTACCTGGGAAA
TCGCGTTCTCCAAGATTTGGACCTTGTCACTCGACTTCTCTCGGGTTGCACTTAGCTCCTGGGCTTTTTTCTCCatctcaagctcaaggcGTTGGTTTTT
TAGGAgtgtttgttgctgtgtttCCGTAACTAGGTCGTACTGCACGAGGAACTGCTGATAAGTCGTCTTGATCTGCATTAACTGATACTGGAGCTCGCCT
ACAATCGCGTGGTCTTCCGATGAGGCCATCAATTCGCgtagctgctcttcttgctgctcacggTTACCCTGCTCCTGGGCAGATCGTTTCGTTAGTACAT
TAGCCTGAGACGCCGCTAGCGAAGCGATGTCCTTGTACTTTGCGCATTCAAGAGCGAGGCTCTCATAGAGCTGCTCAACCTCGTTAATTCTCTCGTACAA
AAGCGTATTCTCATTTCGCAGCTCATTGTCATCTCCAGGAACCCCCTTGAGCGGTGGCGCTTCCACCAACTCGTCGTCATGACGTAATATTTTACGGCTA
GCTTCTTCAAGCTCCTTCGCACGCTCGgtttgcacttgcagctcgttctccaatTGCGCTATCCGATCTTGAAGGATCCCTGGGTCGCAACAGatttctc
cagcaccactttTCGAACTCTTTTCTGCCTGCAGTACCATGAGACTGTGTTGCGTTCGGCTCAGTTGGGCTGGCAAATCGTACATCTCCAGATATTTACC
ATGCATTTCTGCGTAACTTTCACTTAGTGCGTTGTatttcttcagcacgtcAGTCATCGCACGCAGTTGTTTATCAGCAAAATCGCGCAGCACACTTTTC
TCCAGAGTCTTTTCCATGCGTTCTATCATCTCGTCGGCGCCCTGCTTCCACGTTTCGAGGTATAAAACTCGATACTTCAGCGTCTTTTCCATCTCGCTCC
ACTCAC