Description :
From Genome Similarity Track
Location :
Scaffold_16:496376- 497944
Transcript NameFunction/comments
Phyra_42484phospholipid-transporting ATPase, putative

Sequence
1568 bases(100 bases per row)
ATGTTGTCCTGTGCTGTGAAGGCCGGCCATCTGTCGGTATGACGGAACCGTTCTTCTTGGCGGCTCGATTTGCGTGCGGAAGGCGGGCTGGCACCGCAAC
CGATGCATTGCTATTGTCGTTCCACTGTAGGAGCTTGCGGTCAAGGTTGAACTTGATGGTCTCTTTGGCGAGGTGCCAGTACTCTGGAAAGAACGTCGAC
CTGATGCCGTTGAGTAGATGTGCATACGAGAGCGCTGCCACGGGGACGAACAAACAGACCAGCCAGAAGGATGGAAGCCCAAAAGCTTGCTCCAGCATCA
ACTCCCATGTGAGGTCCGAGAGCATTGCAACGTGGCTGCACACCAATGCAACCAGAAGCCACACCAAAACTGAGCCCATGTAGATAAAGTAGTTGAAGAA
GTAGAAACTGTTCTGGAACATGAACAACTTTGAGTTGGCGATAGTCACGACAAGGGTAAAGACGATAAAGCCCTCCAACCACATCGACGGACTGCCTCCA
GAGAAGCCCGCGTTGTTCATGCTGTGAATTGTGATAAACGTGATGATAATACTCTCCAGGATCGCTCCAACCACCCACAAGGAGAAGGTGCTGGTGTTGA
TGTCTTCATCACGAGGTCCCGTGAAATAGAGCTTCGGAAATGTCATGGCTACATCGTCGTTGACATCTTGGTCCAAAATGGAGGAGGCAACGATCGGAAT
GGCCGTCAGGGCGATATTGTACAGCTGTGTTCCGCTCTCCAAGAAAAACTTCTGTCCCGAGAACCCGCATAACAGTGTGTACCAATATTGAGCAGCAGTG
AAGAGGATGTTCTTGTAGAATATGAACAACACTAGCTGAGCCATTCGCCTGTAATTCCAACGACCATGCACAAGCAACAGGCGCTGCAGAAAGCGAAATT
GCGCGATAGCATAGTCACTGGAGTTGACAGCTTGCATGCCCTCTTGGCCTGAAATTCCCACACCGACGTGCGCTTCTTGGATCATTGAAACATCGTTCGC
TCCGTCTCCGATAGCAAGAGTACGAACTCCAGGTACGTACTCCTTGATCAAAGCAACCATCTCCGCTTTTTGGGCTGGTGATACACGGCAAGCGATAACA
GCTTTGCAGTATTGCGAGAACTCGGCGAGCAGAGGACGGCACGACCCGCGAAGGGCAAACATTAACGTCTCACCATCAATGACAAGGGCCAACTCGCGGA
GATCACCTCTCGTACTGGGAGGCGAAGCGAGGTAGACAGTCACATCTGCACTGCGGGCTCCAATCTCATCTCTTAGCGTGCTCTCAAGTACTTCGGGAGT
TGCTGCGATTTTCGAGTTGATGATAAAAAGCTTCATGTCGTTCGTTATAAGCTGGCAAGCGAAGCCGATGTTGATAGCCGTCTCCTCCTTGTCACCAGTG
AGTACCCAGATTTTAATGCCCGCACACGCCAAGTTGGCGATTGCGTCAGGAACACCAGATTGCAATTTGTCCTCGATTGCAGTGGCCCCAAGCAGCTCCA
AGTCGCACTCAATCTCGTTCATACATTGGTCAATTGCGTTTGGGAGGTCCTTCTTTCGCTTGTCGATT