Description :
From Genome Similarity Track
Location :
contig_7:49637- 50642
Transcript NameFunction/comments
g2318.t1RAW33336.1 hypothetical protein PC110_g10352 [Phytophthora cactorum

Sequence
1005 bases(100 bases per row)
GTGTACATGCGCGCACGTCTTGCACTTTTTCGAGAAAGCCTTGGCAACGAACTGTTCGCATCGGCAAGAGCTGCATGGCCCTTGGGCAGCAGCAGCAGCA
GCAGTCGATGGACGGCGTTGAGATCCACCAGTCGATTCAAACTGGGCGATGCCATCCATGGCTTTGTCGAGGGCATCGTACAAGGGCTTTGCGGCACGGG
GATGCGGGACTGTTCCACTCAAAATCTCCTCCGGTGTGAGTTTCTGGCCGTAGAAGTTGCTGTTCATTTCTGTCCGCGCCGTGATGACAGCACCATGCAG
CGAAATGCCCGCAAAAAGGCCACGACTGTGCGAGTAGCTGTAGTTGGCGTTGAACCCACCTCGGCTAGCAGCTGCTTGTGCCAGCGCGTCGCGTCCGTAA
GGCCCCACCGCCACGCTCAATCCTCCTCCCACGTTAACTTGTGTTCGGTGGAACACCTTGACGGCGTTCTTGGAGCCCATAATAATCATAAACTCGATGA
GCTCGCCACCACCCTCGAGGCCACCGCCAATACCCGCAGTACCGATGGCAGCAGGCGCAGACCAGGAGCCATCATCCAGCTTGGCAATCACAATACCCGT
ACCTATCTTGGCTGTAATAAGCAGTCCCGCTTTGATAACTGTGAGGAAGGCGATACCTTGCGCTCGCTTGAGGAAATTGACAGGGATATAGCGGTCGCTA
TCAGCGCCAAAGTCTGGACGGAAAAAGTTACCGAGAATGTCGGCTGCGGAGCGGCACGCGCTCTCCAAGGACCGACTGTACGGTAGATGCAGTCGCGTCT
TGGCTTCGTGTGGGTTCTCCTTGTGACAATTCGCATACTGCGAATTCAGCCCGTCTTGGAAGCACTGCAGGATGGGCGCGCAGATGGTGCAGACACGTTG
CGGGTGTGCGGGGTCGTACTTCTTCCTCATGCTCTCACTCGCCACTTGGTCGGGCGAGATGAGCATCCTCGCAGGAGAGCACGAGTGGCACACGCTCGCT
CCGCA