Description :
From Genome Similarity Track
Location :
Scaffold_1:49636- 52663
Transcript NameFunction/comments
Phypl_g15hypothetical protein PHYSODRAFT_309438
Phypl_g16hypothetical protein PHYSODRAFT_349212

Sequence
3027 bases(100 bases per row)
GCTTCCACTTCAGCACCAGTTACACGTCCACCAATGTTGGCCGGGGTAGTTTCAGCGTTACTAGTTGCGCTTGCTCGGGTCCAACAAATAAGGGACGTCT
GGACCACTGCCCACATATCGGGGAACCGCTTAACGTTAAGGTCCGCAGCGAGTTGACAAACCATATTGTCGTTGTTGCTCAAAAATAGGGATACCTTCTT
CACCGAGACTCCCCACTCCCGCATAATGTCGTTAACCAGCTTGTCCACACGACCATCTCCTGTGTTTACCACGCCCAGGGAAAACGCAGCCGGCTCGAAA
TCCGAGTTCACGTGGTGGCACAACAGCACCAGGTACTTTTCTCTTCCGTAAGAGCTCTCGTACTCCGATTGCCAGATCTCTGCAGAGAGCGAGAAGTGCC
CCACCTCGTGATGCACACGCTGCATGTTCTCAAAGCGTtgctccgccgccttgtgCTCCACTATGCGGCAAACAGTTTCTCGGTCGGGCAACGCAGTTTT
TCCCATTGAGAGGAAACTGACGAGATTAATGAAGCCCGACTCGACCACAGTCGACAGCGGCTGCAAGCTGCCACAGATCCAGCGAATCAGCAGGTCCATC
ATCATTGGGTCTCCAGAGTAAATGGCCGCGAGTGCATCATCCCGCTTggtgcgcttcttcttggtcagcggTTGAcaaacgctgctgtcggGTTCGCTTG
GTTCCATTGGTTCATCATCGTCCATtgacgactcggacgacgagcgcttcgcccCGCTCCTGCTATCAGCTGGAGCCTCCCCTTCGGTCTCCACTCCTGC
ATTGAAAGCCTCCAGCTCTCGGGGGTGGTTGCCTGTCATGTGCCTGCGCACCGAAGCGCTGGATCCTTTCTGGAAGGGGAACGCGACGTTGCATCGCAGA
CAATATGcctccacggcgtcgtcactACTCCATTTCTCTTGGCCGGGAGGGAGGGAGGCGCCGGGGGGAGCGACGAGCTTGATGCACTGCCAGTACGCGG
GGCGCCGGATGCGCGGACACGTGAAGAGCGTCAGGTCGCCGCGCTTGAAGGCGTTGCTCATGGTTGTGCCAATCAAAGTGTGACGCAAAATAACCAAAAT
ACAGTACCTATCGCTGTTCATTTGATTAAAGTAtggcaagttgaagtgtaCAGTTGACATCGCAATAACCCATTCGTCTGCCAGATACGAAAGTCATGGA
GAACCACTACGACATGCTGCAAGTGCCGCGGCGCGCCACTGCCCAGGAGATCAAGAAACCTTTTCGCCTCCTTGCGGTGACATCCCGACAAGCACAAGCA
GAATGGCGTTTCCGAGTCGGAGGCCAAGCTACGCTTTCAGCAGATCAAAACCTCCTACGAGGTGCTAAAAGCCGTGCTCGAGCAAAAAGAAGAACGATAT
GTCACCCGCGCACGCAAGAGAACCCGATACGGTAGTCGTGGTGAGGCGAATAGAGCAGAACACGCAACTCGCTAGTGCGATCAAATATTTGCCGCGGTGG
AGCGTGACACCCAGCAGGTTCTCCAGGAAATGGAGCGTCGCCTTCAAAgggagctcgagaagattAGACGTCGATTCCAACGCAGGGAGGAGATAAATCG
TAAGTTCTtgcaggagatggaggatCTAGTGCGTCAACGAGATCGGGTGATGAAAGAATGCATCAACAAGAGCGGCGGACGAAATTAGCGGTGAACGTCG
TAGGTGGGGTGCCGTGGCAGGCGAAGTGCTCTTCTTGAAGTTTGCATTGTACCTGCTCGCAACCTGTTCACCTAGTGTGCGTACTATACCCACCTATTCC
GAGCATCGCAGGCAGGTAGGTCTCCAAAACTAGCACAAGCTGCTTTTCGGTTCATTTGATTTCAGTACCGACAAACTTTGAATGAAAAAGTTGAAGTTTG
AAAACTGCGCCAATTCACTTTGGAATTTGCCGCCTCCGTCCCAGGACACCTCCTATCCGATACGGTAGGAGTCCTACCTTCAAGGCATGGTGAATCACTA
CGAGGTCCTGCACGTGGCGCAAGGTACTAGTCCCttggagatcaagaaggctTTCACTGCGCTGACACCCGGAAAACCGAATGGAGCCTCGAAAGAGAAA
GCCACTCGACGCTTCCAGTTGATACAACACGCCTACGAGGTGTTGGCTGACGTCAACAATAGGAGCATCTACGACGGGCGCTTGGAGAGAGCCAAGAGCA
GAAGCCAAACTGAATCTCCATGAATGTATTGCTTTATTCTGGAATACACTACGAATATTGTTTTCCGTGGCAATCTCTGATTCTGAGTCCGCTCTCTGAT
ACCAGTCTTTGTATCAGCCGAGTATAGCAAATTGATCACCATGCTGCCGCGAAGCAAGAGGAAGGACGACGGCACGGCGGCATGCGCATCCGCTGCGGCC
ACCATCTGCGAGCTGTGCGACCTGTACACGCGCAACGACCTGGGCGGCAAGTGGTCGGAGCTTGCGGAAGTCTACGACGTACGTTTCTTCTCACGAACAC
ATCGCCAGCAGACCCGACACCTAACTGCCAGTATCATGCCCGTGCTGCTAGCAACGCCGCAACGTCGACAACTTCCGGGAGATCCTGGATCTGAGCGCCC
CCAGCGCGCGGATGGGCGATCTGAATGGCTGGCACTTGGAGCGCATGGCCGTGGGCGAGTTTGAGCCTGGAGCCGgtgccagcgccaacgacTTGGCGga
gatcaagcgcgagaGCCGCCTGATCAAGCAGACGCTCATGAAGGTGATGGCCAACGGCCGCGACTTCAAGGCCAAGcgagacgagctggaggcagcGATG
GCCAAGCAGCGGGTGGCGCTGACGGTCGAGCTGACGGAAGCCAAGGAGTTCCTGGGCCAGGCACATCTGCTGAGCGCCTGCGACTCGGCCGCGATCGAGG
TCAGCGAGCCGGCACCTGTGGAGGAGCGACTGCGGGCTACGGTCAAGCACCCGGAGCTCTCGCCGAGGGTTGATCTCAGTGAAGCACCATCGATCTAAGT
ATGAAAGACGCCGTGAATACTGAAAAC