Description :
From Genome Similarity Track
Location :
Scaffold_129:4963- 13953
Transcript NameFunction/comments
Albla_Nc14077860PREDICTEDx3a similar to ENSANGP00000028549 putative

Sequence
8990 bases(100 bases per row)
TTAATTTTCCCAGTCATTTACCTTTCCAAATTCTGGGTATGGTGATTAATACTTATTAATGCCGAGGGATTTAGAGAAGTCGATTGTCTATCCTATTGCG
GAATTCCTTTCTGACCACATGATGAGGCACTACATGTGGATAGATTCTCCCGGAACGTAGTAATTTGTTCTCAGGAGGTTATTCAGGAACATTATTAATG
TCAGTAATGTTTGTAGCATTAGTTCATGGATAGTTTAGAGTAGGGCTTAGATTAGCTTACAGTGAACTACGGACCTTCAGTTTAATATACGTACTTTTCA
TTTCACCTTCTTCTTGCCACGTCCTCTTCTCATCATATACTGTTGGCTAAAACAGGTTGCAGCCAAGACGACTAGCACATTCACATCAAAAAGACTCTGC
TGAGCAGCACAGGAAAGCTCATTATTCCAATCCTTTTTTGTAACTGGAAGTGAAATCAAATTTTAAGTAAGCTTTGGCTTATTATATTTTGAATGTTCAT
TTGGTACAAAAGAAAATGATGATATAAATTCAATTACGGTCATTAGTTGTTTTCACTCTCCTAAAATATAATCTTTATGTTTCTTTTTATTAGCTCCCCA
GTTGTATCCGTGATGGGTGGAATGAATCAGACGATATCTTTATCGAATCAGAGGAAACGAGTTGTGATAAGATTGGCTGATTTCATCTGGACGCTTTTCC
TATCTATTCTATTTTTCGCAATAATAATCTAGTATTCGTTGAACGTTCTCAGTTAATATTCTGTCTGGCTCTACATCATTCGCTGTCATAGTTCCTCCTA
CACTCACCCATAGTTTTGAAATCTTGATGTTTGCCTTTCTAGCCAGATGGAAAACTCGCATGACTCATATAGGTTTTTTCAGAATTCAGCAGCCTGATCT
TTATTAATTGAATTGCATTGATTGTTTACATACCACTATCTCGACGCAAAAACATAAATTGAATATCAATATGTTTAATTTGTTGGTGTCAAATTGGAAA
GTGAATATATATTTGTAGGTCCTTAGTTCTCAAATAGATAATCTAAGCCTATACCAAATTCTCTATTCCAAACTATTAGTAACCTATTTCTTATCTCACC
TTTCCGCGCTATTAATGTTCTGATCTTATCCGACTCTTCTGATTGCAGGCTTTCTTCAACATTGGGAAGGAAGAGTACCTCCGTACGGAGCTCTTGTCGT
ACTGTGAGCCACACCGGGTTGCTTGGTACGCTTCCGTTTTTAACACCTCCATCGGCGTATAATTCTCTACGTGCACGCATCTTGGGTGCTGAGATTGGCC
AAAGGCCAGTGCTGACAAAGCCAGAAATCACATTATCTGGCATGGCAAGCACACCATTTTGCCACGAGCTCGATGCTAATGAGATTGCCTGTTTCTTCGT
CAAGCTCGACACATCTTCATCGATCATGAAGCGGTCCATGGAGCGACGCAGGTTGGTCTCGGAGAGCTTGAACACAGAGACATCTAAGGGCTGCAAGATG
TGTGTGGAGTTTGAGGAAGAAGAAGTAGAAGTAGAAGTAGAATAATCTTCATCTCGATCCCCTTCTCAACGATCCTCTTGCTGTAATGGCTTGCAAAGCC
GTCGTCGATGAGCAGCAGTGGCCGAATGACGCTGCTGGGTACGCTTGCTGCAAAGTGCTCCAACCACTTGACGAAAATAGCTTGGTTCATGAACGCCTTC
GGAGCGACGGCAACTGTAGCACCAGGGACGGAGCACTCACTCAGGATGTCACGATTCAAACGTTGGCCTGGAAGAAGGAAGAGTGGCGGCAGACACGATC
CGGAGGCACTAACACAGGCGACTAGCGTCAGGTGGAAGCTCATGTCGATGCACTTTGTCCAAACGTTCTTGGACCCACGCACAGCGATGAATTTCTTTGA
CTTCGTTTTCTGACCAAATCCCGTCTCGTCCATATTAAAAACGCGGTCGTTGGTTAGTTTGCGCTCGATCGCGTGCTTAGTCAGTTGATTCAGAAGATGA
TCGAGATTATCTTACCGGACTTGGTTGCGTGCGCGAGAAATCACTTGAGGGACTCTGAGTGAAGGCTTGGGGTGACGGGAAAAGAATCGCTTAACCCATC
CGTCGCCCAGGAGGCCAGCCGATCGCGCGGGACTGTAAAGCACGCGGTACGCCTCGTTCGCTTTGCTGAGTACCATCTCACGCGTAACAGGGAGACCCTC
TCGCTGCATCCCTACGATCCACGTCTGGAGGTCGTCTTCAATTTCTTGGGAAAGAACGGGCGGTGGTCCGGTTCTTCTTATTGTCACACCAGAGCGCTGT
TGGATAGCGCGGGGGCAGATCGTTCTTTCTGGAATTAGGGGAAGTAACTCGCGAACGGTGTCCCACGACATACCACGTTCACGAGCACTGACAGCCTTCG
CAAGATCGTCTTGGCTATAGACCTTTCTCTTCTTCATCGTGCGTTGTTGCAGTATGTGATCAACCTGCGTTTGACGCGTGTGGGCGGCCATAAACTGACC
CATTCGTTCAAAAAGCCAATCAGATCCCTCAGAGTTGTCAACTCTAGCATTTTATTGGCTACTGCCGATTATCGGCCAAAAACTGGTCGTCGGCTATAAT
CTGGCCTGATACCTTGAGAAAGATTTGGACGAATAAGCCGAAATCACAGAACTTTTCGAATTTCCCAGGGAATCAATATACTTCACGTCAAAGTACGGCT
GCAAAATTGTAACAGCGATCTGGAGATAGCGAATACAATTTCAATGAGCGCTATCAAGGATGGCAACGGAGTGAAAAACATTAGAAAACGAAAGACATCA
CGTGGCTTGACCACGGGGAAAGTAGCAACTTGAAAATAGCTTGCGAGATGCTGTTGAAAAAGGTGTAGAGCAAGAGGATTGGAATAGTTGTGATGCAGAC
CAGTGATCCACAAATGTCCCACATGTGAAGCGAGGGAACTAAAGGAGGGTTAGGCAGGTTTATTTCACTTGAACATCCCAATTACGAGATTATAATATAA
AGAATTTGCTAACCGCGGCCGATCTTCACAGCCGTCTCACCTCTCTTAGGTGAACGAGGAGGATTGACAAGTCGAGTAAGAAGGCAACATGTGAAATGGA
GAATTACGACGACCATTTTATACTAGAAACACGATCAGGAAAGCTTCTCAACCTCATTGCTCAGATCAACGAATTTGCTCTTATTTCGTTCAAAAAAGTA
AGGTGGTGGAGAGCATTAGTGCCAACCCCGGCTTGGATATTGTTTTATGAATAAAAAAGATGAGCTGAGTTTGATTGTCACGAATATTACTTGGGCTGAG
AAATTGGCGGACTGCATCATGATATTGATGTTTGAGTATGAACCGCGAGTAAAACAAGCAGAAAAAACGATTTTCGTTTTCAACGAACGGTCAATCAATC
AAAGTCATCATGGATATTTGAATCGCCTAAGAAAGGAATATGGGGCATGGATATTGATGGCTTTACTTGATGAAGTGAGCTTTATAATCACGATTTTGCA
TAATGTGTGAGTTTTCTTTCAAAAAACAAAGGTGGAATTTGTTGATCGATTTGCTTAATTCAAATATCACCGAATTACTGTTATCGAAGAATTTAGTGCT
TCAGAACTGACGACGGTGAAGAAAACGATGACAAAAGACTGTGAAATAAATGTGAAAAAGCAGAACGATATTACAAACGTGTGCTCTTACTTCCCACAAT
CAAAGACAACTCCCTAATGAATTAACATGAATAATATAGATATGGCGAGATCACAGCTCTCGTGCGTAGAGATAAGAATAGACGTTTGCTGAAGCCGTCA
TTACATTTTCATTTATCAATTGCAACTACGAGCACTTCATCCCGTTAGAGATCAAAACCACAATAATTTGATATTTAGCAATGAGCTAGAATTATGAAAC
TCTGAAACAGAAGCATAAATTGAGCTATGTATATCCAGATAGAAATTCGGTCAAGGTTTGAGGAGAAAGTCTGCTCATGCATACATCTTTGTTCCCTGGA
GATTCAAGGATTGTCGGATACTGAATATATATGAGTTGAAATATTTCAATTGACGAGATCAGCTAGTTTTGATAAGAAGGCAAAGATTCACAGTATGAAA
TTGTGTGAGCCGGGAAGTTTGGAAAATGAGCTAATCTTTTAAGCAATCCCTAGAGTCTTGAGACAGTAAACGTAGACAAAAATAGGCATGTAAGATGGTT
CCCTTAAGCGATAGATGTAGCCTTAAATCACCATAACCCGGAGGATGCAATAAGAATCACTTTTTGTGAAAACAAAGATAAGCAGGTGGACGAAGCGATG
AGTTTGTTAGAATGCCATTTTAGATTCAGACTCATGCTGCTAAAATTGCACCTTCTTGATGCGAAGATTCCAGACAGCTTGTGTTCCCTCGAAATTTATT
GAGCTTTTCAAAGGAGCAAAGTAGCATCAACATCTCACAATAAAGTCCTTTAACATATACAGCACTGGAAGCACGTAAAATGTACAATTTCGCGATTGAA
TGCTTTGAACTATCATTCCGATGACCTTAAACCAATAGGTATCGCCCTATAAAAAAGACTAGGAGGTCTCTTGATAGTTCCCGAAAGAGAATAAAATGGG
CATTTATTGGATTTTCTTTCTTTTCTACATTTAGAAGCAAAGCAAAGGCGGAAGTGTTTTACATGTCTTGTTTCACCCCATTCTGTTCATCTAGTTCGTT
TAAACAACAGGTACAGAATGTGCTTCAATAGAATCTCCCGCGCTTAGCCATTTTGTTTTTGAGCCTACATAGCGGAGTATGATATGTATGCGGCGTACTG
TGTATCTAAAAATTTAATGGAAGTTTTCATCTTTATTAGAAAAGGTTTTCAGTCAATATAAACAAAGTTGAATGCTAAGTCAAATTTTAGAATTGATAAC
GGTTGCAGAGACGTAATTAAAATCCCGTTTTTACATTTTTCCTCAGAGTGGACATTGAGCAGGGGAGATTTAAATCTCAATCACTTACCTTGGTTCGAAA
AAGAACGATCTCGTATTGCCGCTTGCAATTTTTTGTATCGATGATTGATATATATCAGATTCATGCTAAGGAAAAATTGTATTACGGAATTTAGCCGAAT
CATTTACATGATTCACTATATACTCATAATACCATCAGAAGGTGGCTTTAGAAGCGAGGGAGCGTGAGTCATAGTGCTTCAAACAGCGCTACAAATCACT
ACAGTAAAAGCGAGGAAAAGCTAACATTAGCTCAAATCTAGAAAGAACGCATTGATTGACATCTGCACTTTAAAAAACTCGCAAGAACCTAGATTGTTTA
AAATAATCGGAGCATACCAGACATCAAGAATCGCTTCAGGAATAGAAACGTATAAATTAAGTATTTACCGAGCAGAGACATGAGTTATGACGATTTTCAA
GAAATGATGCATGGATCGAGCATCCAGCTTGAAGTATGCTTTGGAAACAATCAAGCTGAAGCAAAATCAACATTTAAACCATTGGTGAATTAAACACAAA
TTTAAAACAAGGACTAAGGAGTAGCATACGAAAGTATGGAATCTTTAAAACCTTTCTCTTCATTTCCGAAAAACTTGCAAAGACATATCGTGTGCGAGAC
ATCAAAGCGTTTTATTTAGAACATCAAACTGAAGAACGTTCAAGAGAATCGATTCGAGTATTGCAACATTTCAAACAATAAAAACGAATAGAACGCTTTT
CAAATGCTAAAAGGACGTCTTCGGCTTTTGTGAATTGTGATGGTAATTGACCAAGCAAAAAAAAACGCTGAAATTTAGTTCTAGAATAACGATTATGGTA
ATGGATCATTGAAGTTGTCCAAGCCAAAGCTACATGTAAATATTGAACTTAATAAAACAAGACTAGAAATACTTTAATTTCCTGCATGTGTGCAAGTAAG
TGACAAAACATTTTTTTAAGGAAACCGAGTGCATTTGTCAAAATCGATAGTCTTTTTTAGCCATTCTTAGCTCGATGAAATTTGAAAAACACGATGTTCC
AACTTCCACGAGATACGGTGACAATCTTACAAATCAGCCTTCAATGAAGAAGACTATCGAATAACGACATATAAGAATGGGTTCTCGGGCTGATTTTCTA
TCCACCCAAGCTTGACAAGCTAATACCGAATATTATTCGGAGAAGCCAACATCAAGAATTCCAAGATGAGAACAAGTGTAAAAGGAAAATTTCGCTACAA
AATTGATGCATAACAAAGGCATGCAAGTACTCTTTCGTCCAAAAACATTCAAAATTTTACCGACGGATTGCTCATGTAGGTCGTTTCTGTTGTCGTCAAA
TTGGAGAGTGAATATACGTACAGGTCCTTAGTTCTCAATTAGATGACCTAAGCGCATACCATACTCTGATATCGCTTCTCTATACCATGATAAACATATT
TCTTATCTCGCATTTCCGCGCAACTAATGTTCTGATCTTATCCGATTCTTCTGATCGCAGGCTTTCTATAACAGTTTCTTTGATGTTCATTTTGAGAAGT
AATGGTCAGGTTTGGACAGCCAAAAAGCAAAAATGAGCTTGACTAAAATCTTTATATTTCCTGACTACAGACAGGCAGCCGTAAATTCTCACAACTACAA
CACACTACTTCGAACGACGCTGTTCCAAGTGTAAGTGTCGACTCATTCGACCGACCAAAAAAGCAACCCCTGGATTGACTTCCTTTAAAAACGTAGAGGA
GTGAGCCTAACACAGCTAGAAATACTGCATAATTAGAAAATCTCTACTTTACTTCAATTTCCGATCAAATTGGGCTTCGATCTATGGACATTGAAATGTC
TTTGCGTCGGGCTGATTTTATTTTAGCACCATTGGTTGGAAGGTAGAAGCTTGAAAGATCTATATTGAGTTCGTCATGATCATAATTAACTCACTTTTCC
AGTATGTGTAATTTTTCGAAATCCTGTAACTTGAATTGCACCACTGAGCTCTGAAAAATCTCATGTATATCCCCATAAATGCCCAGGCACTCAACGAAGG
TCAAAACGCATTACGCGACGTATACTACCGAATTGTATTTTCGCGAGCAATCCGTGAGTCTGTTCGCTAGTGCTCAAATGCATTTCTCTAAAATCACTTG
CGCTGTTAGCGCAAGCCAGGTTGCTAACGCCTGTTCCAAACCATTTAAGCGAGAGTTCGGATGTCCAAGAACATAAGGCCGAAACTTAGCAACTCTGCGA
CTCTCTGTCTCTCCGAAATGCGTTTTTGTTAGCACATTGCTAAATGTGATAGCTGAATCGCAACAAGGCGTTCGTAGGCCATATTTCTAGTTCACCTTAG
CAATTGGTGCAGATGCCGACACATTGTCATCTTCATATTCCCATGCTTCTTGATACTGACAAAAAGTCCAGCGAAGGGCACATATTCAATCAACTTCAAT
TCCCTTCAGACTGAAAACTCGCTTTGTTAAAATTGTCCTTCGTGTTCCGTTTTAGCATCTCGCTTCATAATTCGTTGATGCTGAGCTCTATAAGTGATTG
ACAAATGTCCTGGTTCCATTCAATTGAATTTGGAGATCTCGTTGCCGTGTTAAGTTGTACGTCGGTGATCTTTTCAAAGCTTGAATGGTATCTTCGTGTT
CGATAGAAGATGACTTTTGCTCGGATTGCTAAAAATCGATTAAGTTTCGTGTGGTATATAATGATGGTTTTGCACTTTCTGGCAGGTTGTGTGTAATAGA
TTTATGTCGAACATCATTGAAAATATTATGTCTCCTCATGCTCAATGTTTCAATTTGTTTTGACATCCCTGTTTATACTATCTTTACTTGTAAGCGGATC
CCGTACATCACAGCTTCCTTTTTTTCACAGCCTTACCACCACCCTGCTATGTTTTAAGCATGTGAAATTCATCACAGCTTTCGTTTATTCTAGAATTTAA
CCGTTATATCAAAATTCATCTTCGAACAGATAAAACATATTTCGACCATTTAAGTATTTCGAACGCGGTTGGAGGTATTGATTGTATAAGAAGAAAAGAA
ACTATTTCTTACACCTCGCTTATCATTTATCCCTAACTGACCCACAGAAATACCTTTGAACTTTTTCTGTCAATTTGCACGTATTGGATTAGATACAAAA
AATCCGAATGAAACGTATTTTGGCGATCCAGGTCTCCTGCAGAATATTGTCACCTGTAGTGAGCAAATACCATTTTGAAATCGATATATATAAAAAATCA
AAATCACGAAAGCGCTTACTATACTCAACGACACCCGATCGCAATGACTGTGGCGACACGCATTCTCTTGAACAGCCAGCAGAAGAGTGCGCGGCGACAG
TATCACGTAGCGCACCAGGACATGTCGCGCCAAGAGTTTAGTGAATGGGCAGCGTCTGCATTCAAGCTGCCATGTTCACTCGCCCGAGTGTCACTGATTG
ACCTGCTGAGGCGCCAAGAAGACGACACCGAGCGTAACCCGCTGCAAAAGGCAAGTCACTGCGCGCAGTCACCTGTGTTGGAAGCGCAGTTAGTGGTGTG
AATCAACAGGTGCGAGGAAGTGAAGATCCCCATCGTCACAGGAGCAGCCATTCGGTAGAAAGCAGAGATGATGCTCTATGCTCTTAACTACAGCCACCCT
AACCACTGCTGCTGTGCTTTCAAAGTTGATGTTCTCAAAAGGCTGGCTCTTGCAATTTCAACCGCGGCAAGAACTCAAATCCAGGCGAAGCTGGCTCGGT
CAAGACTACTGCAATTGAGAATGAACGCCGCGTGCTATAAGCAGTTACAAGCCTGTAGGAAAAGTACGATATCTACAATATGGACGAAACTGCGTACTTA
TATTGCTCGATTCCCGGCAAAACCATCTCGAAAAACCGTATCCCCTGCCGGAAGAAGATAAAGAAGTGCATCACCTTTGCAGTGACGAGCAACGCCTACG
GCTCAACCAAGATCCCGCTCTTCTTCTTTGGTACGGCTCGGCAGCCGTGATGCTTCGGAAGAGTGCGGCAGTGCTCGGTATTCAAGATGC