Description :
From Genome Similarity Track
Location :
Scaffold_688:4963- 11800
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_688-snap-gene-0.4Glycosyltransferase

Sequence
6837 bases(100 bases per row)
CCGGAAGCGAAGAGAACGTGACGATGGCGCAGGCCACGGCGGCGAGCAAAGAGCGTCGGCGCGCAGGCTCCAACTACTTCCAGCTGGACGCCGACCGCAA
GCGCAATAATTCGACGCGCTTCCCGAACGGCGGCGGCGGCAATGGCGACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGACGTCATACCGTCG
CACAATCAGGGCGGCGCGCCGAACGTGAAGCTCGGTGGCGGGCTCCAGGGTGACTTTGACGACGAGGTCTCGATCGACTACTGCTGCGAGGTGCTCTTCA
ACAAGTTCGGCTTCCAGTCCGGCTCAGTGGACAACCAGCGCGAGCACGTGCTGCTTCTGCTCGCGAACGGCAAGGCGCGCTCCAAGCCCTCGGACAAGCC
CGGGCAGCACGTCGAGACGCTACACAAGAAGCTGGCGTCGAATTACTTTGAGTGGTGCGAGTTCCTGATCATCAAGCCGGTAGCGTTTCAGGGTCCAGTC
CAGGGAAACCTCAAGAACACGCTACACATGGAGATCATGCTGTACCTTCTCATTTGGGGAGAAGCAGGCAACTTGCGCCATATGCCGGAATGCCTCTGCT
ACCTGTACCACCAGATGATCACAATGCTGAACAAGGACCCACTCGGACAGGATCGAGTGAGTGAAGGCTGGTACCTTCGCCAGGTCGTTCGCCCAGTCCA
CAAAGAGTGCAGCAACATGCAGCGAAAGAACAGCCTGGGAAACCACTTGGAGCACACGCAAGTACGCAACTACGACGACATCAACGAGTACTTTTGGAAA
AAGTACTGTCTCAACATCGACGTGACGAAGATCGGCGAAGAGCTGTCCAAGAACCACGGCAAGACGTACTACGAGCACCGCAGTATCTTCACGCTGGTGG
TCAACTACTTTCGTATCTTCCAGTTCAACATGATGTTCTTCATCGCGCTGATCGTGCTCAGTTTTGCGGTCACCATCTCTCCAAGTGGTGGCAAGGTCTG
GTTCTCTCAGTTTGACACGCTCGGCGAGGTTGTCGCTCCGTACACGAAGCGAGACCTGAAGCTCGCGTTGATTTCCCTGGTCTTTTCTCATGCCTCGATG
GCGGCTTTCAAATGTATGCTCGAGGCTGCGCACGGCTGGCACCTTTTGATTGCACGCGAGTCATCCGAGACGTCTTCGCGGTCGCTGACGTACGGTGGCG
CGCTCGCGATTCGTCTGCTCTGGAATGGTGCGTTTGCCGGCTTGTTTGGTTGGATGATCTACGAGCCGCTGCACTTGGAGAAAGATACTGAGCTTCTGGA
CAAGGCCCAAGTGGCGGCGATGGCATTTGTGACTCCTGGAGCCCTCGTTCTGCTTGCGCAAGCGTTTGTGCCCCACCTCGTCACGAAGACTTTTGCGGCG
AAATTCATTCGTGAAGGAGAAACCTGCTACGTGGGACGACACATGGCGCCGCCGCTCTACTACCAGTTCAAGTACATCACCTTCTGGCTAATCCTGTGGG
CGCTGAAGGCGTTCATCTCGTACTTCATTTTGGTTCGTCCGTTGATGCTCCCATCGCTGGCTATCTACTCGATGACTCTGAAGTACAGCAGCAACGTCGT
CTCGTTCCACAACCTCGCGTACATTTCAGCGTTATGGATGCCTGTGGTGTTCATCTTCAACTACGACACGCAGATTTACTTCACGGTGTTTCAGGCGCTT
CTCGGAGGTTTTCAGGGTCTGCTGATGAAGACTGGCGAGATCCACGGCATTCACGAGATCACCAAGGCATTCCGTGTGGCTCCCCGACTGTTTGACCAGA
AGGTTGTTACCTCGCTCGCGCGCTCCAATGATGCTGCCAACGACGGCTCTGCTGCTGCGTACCAGTCTCAGATGATGCTGCGCTTCGTTGTCGTCTGGAA
CGAGATCGTGAACTCTTTCCGTGAAGGCGATTTAGTCGACGACAAGGAAGCCGCTATTCTGCAGTACGACATCCAAAGCTCGGGTGAAGTGTTTGAGCCT
GTATTTTTGTCTGCTGGCAAGCTCGCAGAGGCACTCGAGTACACTGTGCGTCTCGCGAAGGAAGGAAAGGGCGATTCGCAGCTCCAGGTGTACATGATGA
AGAAGGACTGCTTGTCTGCTGTCCGAAGCTTTTTCACTGCGTGCATGTACGTGATGGAGGCTCTGCTCGGAAGCGACGACGCAGATGTGCTGGATGCTCT
TCGCACCATCGAAGATATTGCCAGCGGCGGGAATTTCATGAAGACTTTCGACGCGAAGAGCTTGACGCAGCTTCGCTCTGTCACCATGGAGTTTTTGGAA
GCGGTGATGGATCTTCCTGACCCTGACACGCAGTCGTCGCACTTGAGCTCTTCGCGAGTTCACACGATGGGCGTTGTCCGCAATTTTGTAACCAAGATGG
AGAACCTCCTGAACGCGATTCGTATTTTTGCCAATCGTCCAGAGCTTGCGTCGAAGTTCGGGAACTCGAAATTCTGCTCGAGTGCGAATGGATACGTGTA
CGCTTCTCGTGGTCTGGTGAACCTGTTCCACAACGACACTGCGATGGGTGCGGCCACTCGCGCATACCTGTTGATGTCGCTCGACCGAAACGACGCGATG
CCACGCGTCCCGGAAGCGCAGCGTCGTCTCGGTTTCTTCATGAAGTCGTTGGTGATGGAGATTCCGCAGCTGCAGGCGATCAAGGAGATGCGCTCGTTCT
CTGTCGTGACCCCGTTCTACAGTGAAAGTGTGCTGAACTCGTTGTCCGAGCTGAACAAACCTCTGGTTAACCACCCGATCTTCAAGAAAGTCGAAGAAAG
TGGCAAGAACATCACAATTCTGAAGTACCTGATCACCATCCATCCAGAAGAATGGGAAAATTTCTTGGAGCGCGTGGACGTGAACACTGTCGAGGAGGCT
CAAGCGAACTACCCGATGGAGATCCGTCTGTGGGCTTCCTACCGTGGTCAAACGCTTGCGCGTACGGTTCAGGGTATGATGCTCTACGAAGACGCGATCA
AAATCCTCCACTGGCTCGAGATTGGTTCTAGTCCCGGCAAAACGGCTGAGCAGAAACAAGCGCAGCTGGAAGATATGGTGCGCTTGAAATTCTCGTACAT
CTGTGCGTGTCAAGTGTACGGTAAGCACCGAGCTGAAGGCAAAGAGCAGGCTGACGACATCGACTATCTCCTCAAGACCTACCCAAACCTTCGCGTTGCC
TACGTGGACACGATTAATCAAGACGGCGGCAAGCGATTCGATACGGTGCTGATCAAGAGTGAAAACAACGAGATCGCGGAAGTGTACCGCTACGAGCTGC
CAGGTGACCCGATTATTGGCGAAGGTAAGCCAGAGAACCAGAATAACGCTTTGCCGTTTACTCGCGGTGAATACCTGCAAACCATCGATATGAACCAGCA
GCACTACTTTGAGGAGTGTCTCAAGATGCCGCAACTGCTTGTGACTGCTGACCTGCACCCGTCGAAGAAACCTGTCTCCATCATCGGTATGCGTGAGCAC
ATTTTCACGGGTAACGCTTCTTCTCTCTCGAAGTTCAAGTCGTGGCAAGAGTTGGTGTTCGTGACGCTGTCGCAGCGTGTGCTTGCGGACCCTCTGTACG
TTCGTATGCATTACGGTCACCCCGATATTTTCGACAAGGTGATTGCGCTGTCCCGCGGCGGTGTGTCCAAGGCGAGTAAGAGTATCAACTTGTCGGAAGA
TGTGTTTGCTGGTTTCAACTCTACTCTTCGTGGAGGCGTTGTCACGCACGTGGAGTTCATGCAGTGCGGCAAGGGTCGTGATGTGGCGCTCTCGCAGATT
TCTATGTTCGAAGCGAAGCTGGCAAACGGCGCTGGTGAAACCTCTCTTGCGCGTGAAGCTCATCGTATGGGTCAATTCATGGACTTCTTCCGTCTGAACT
CGATGTTCTACTCGCACACGGGCTTCTACTACGCAACGTGGATGACGATCGTGACTGCGTTCGTGTACATGTACTGCAAAGTATACATGGCGCTGTCCGG
TGTGCAACCGGAGATCATCGCCCAAATGAACTCGACGGCGATTATCAATAGCAACATCGGTGGAGGCTTCGACGAGCGAGTGCTGACGGATTTGAAGGCT
GTGGTGAACACGCAGTTCTACATTCAAGCCGGTCTTTTCCTGATGCTTCCACTGATGTGTGTGTACTTTGGTGAAGGTGGTTTGGTGCGCGGCATGTACC
GATTTGTTGAAATGATCATCACACTCGGACCGGCATTCTTCGTCTTCCAGGTCGGCACGACGATGCATTACTTCGACAACAACATCTTGCACGGCGGTGC
CAAGTACCAAGCTACTGGTCGTGGTTTCAAGATCACGCGAGAAACACTGGTGCTGCTGTATAAAGCATATGCAAGCTCCCATTATCGGAAAGCTTTTGAG
TTGGTGGGCTTGTGTCTCGTGTACTTGGTGTTCGGCAATTTCGCCATCGGGCAAACGGATGCACCAATCGGAGACGACGTTTTCGCAATCAGGTTCCGCA
AGACAGCGCAAGGCTACGGCGTGCAGACATTCTCGATTTGGTTCATTTCGATTCTGTGGATCGTCGGACCATTCATGTTCAACACCGACGGTTTGGACTG
GGAGAAGACGAAAGTGGACATTGCTGCGTGGGCGAACTGGATGTTCGTTGACGAAAGCTACAAGGACGACGATCCAGTGAACACGGGCGGGTGGGTGACC
TGGTGGAAAGGAGATCTGAAGCAGCTCCACCAGTCCAACATGATCTCGCGCGTGACGGTGCTGCTTCGCGAGAGTCGCCATTTCATCCTGATGTTCTACG
TGTCGACGATGATAACCTCGGACGTGATGTACGTTGCGTACGCGTTTGGTGCTGCCGTGGCTACCGTCGTGCTGCTGGGATTCGTTCACGGCATCGGCTT
GGGAATGAAGTCTGTTCGTCCGATGATCCGTGCGACGATCTACTTGACGTGCGTCTTGAGCGTGGTAGTTGGATACTTCCTGGCAATGTGGATTGTCTTC
GACAAGAACTTCAAGTACTCCGTTTCGCTCTTCTTTGGCTACGCTGCGGGGCTCTACGGCATCAACGAAGTGATGCGAATGTGGAGTTTCCCGAGCTCGT
CGATCGCAGGTGTGGCCGTGTTCCAGCAGCTTCAGTTCCTGTTTGACTTTTTGTTCTGCACGGCGATGATCATCCCGCTGTTCATCATGTCGTGTGTGCC
GTTCCTCAACGTGATCCAGACGCGTATGATGTACAACGAAGGCTTCTCCAAGGTGATGTCTGGCTCGTCGCAGTATGCGTTCTCTCTGGCGACGTTCATG
GGCATTCTCGGTGGCACTGGCTGCGGCTGGCTGTTCAGTTTGCTCTCGACTTTGGAGCAGTCTCCAAGCTTCTCAAGTTACGTGAAGTCGTACGAAGACA
TCCTCAGCAGCGACCTCGGCGATGGCAAGATCACATTTTTGACATACGGCGCATGCACGCTTGGCACGGTGATGTCTGGTTTCTTGACCTACTTCATCGG
ACGTCGTCTGGCAATTGTGACGGGTGGTCTGTTCAGCACGCTCGGCATGGTGGCTGTCTGCGCCGACGGCGACCTTCGCAAGACGTTGCTGCTTCCAGGT
ATCGGTTTGCTGGGATGCTCGATTGGTATCCTCCTCCCGTCGCTCGCTGTGTATATCTTTGAGATTTCGACTAAGGACATGCGCGGCAAGTCCGTGCTGC
TCCTCGGTGTGGGTTTCGTGATCGGCACGCTCATGAACGGCTACTTCTCGACGGTGAACGAACTCGGCTGGATGTGGCAAGCGTTCGGTGCGTCTGTGAT
GATTGCGTTCATCACGCCAGCGGTGAACATCTTCCCAGAGAGTCCGCACTGGATTTTGGAGCGCAAGGGCTGGGAGGCGTGTGAGGCGTGTCTCGTGATC
CTGCGTCGTAAGCCGGACGTGTCGGAAGAGCTCAAGAGCATTCGCGAAGAAGAAGCGGGCGACGACCAGAGCGGCGGCGGTGCGTTCAAGTTCATGCTTG
GCGTGTTCTTGATGCTGGTGTCGTCGCTGTCCACTTGCGTGCTGAACGCGTTTGTGGTCTCCGAAGTGACGTCTTCGACGATTCTGAAGGACGAGCCGCG
CATGTTTGTGAACTCGGTGGCGCTGCAGCTCACTGGCTCGCTGCTGTCGTTCTTCTTCATCGATAAGCTCGACCACAAGTCGATCCTGTTCGGCACGCTT
GTCCCCGTGGCGCTTTGTGCGGGAGTGCTGGGCTTCAACGAGAACTCGGGCTTCTTGAACGACCTTGACAACGCGGGTTTGTACTACTCGATGATCTGCA
TGCTCATGTACTTCTTCCTGGGTCTCGGCACGACCGCGGCGCTGTGGACGGCATGCATCGGGATGTTCAACACGCGCGGGCGCGCCGCGTCGACGACGTT
CCTGTTCGCGCTCTTCTTCGTGGCGCCGATGGGTTACGTGTTCATGCAGACCGATGTGGACCTGACGAAGAAGCGGTATGTGTACCTGTTTGCGCTCGCC
GCATTCTGCGTCGTGGCGATAGTGCTGCTAGTCGGCGCGGGCACAAAGAAGAACGGCGTGATTTGCACCAAGCGCGAGGCTGAAATCGACCGCGAGAAGG
CGCAGCGCCACCGTGCAGCGAGCCGCAACACGCTGCGCACACCCGGCAGTGCGCGCAACCGCAACCTCAGTCGCGCGCGAGCAAAGTCGAACGCCCCCGC
GAATGCGAACGGTGGCCGCAACTACCAGATGTACGAGTCCCCCGGCGGCGCTCCCCCGCCGCTCAACGGCAACATGCATGCGTAGACCGACTGAGAAGAC
AGACAGTCGAGACTTTCTCCATATTTTGTGTGTATGT