Description :
From Genome Similarity Track
Location :
Scaffold_539:4963- 7292
Sequence
2329 bases(100 bases per row)
TTATCAAAGTTTTATCCAATCAGGGACATATTCTGATAGTACCGTTGTGCTGTAAAAAAAGCAAAATGCTTCTTTTCAGTGAACGTTCACCGCAAAATGG
TGATGGGGTGGTCAGGTTGTTATAGTGCCTGCTGAGCCGACGTGCCCATCACCAGCCTAATAAGATGCATTTTTCCTTCTTAAGTGACAAGTCTCTTATC
TTTGTATAATATACTATAGTAAGGTGGCTTGCAATAGGGTTAATATGGCTTTAATTGAGCTGGAAAACTAAAGTACTTAAAAGTAATATCGGATAAATGC
CGGGAGACCCACAATGGAACCACAGATAACAGACAACCGCACTCTTGCTATTATAGCTTATTGGGGTTTAACGACACTCGCGATATAAAAAAAGCGAAAA
AGCCGACCGTGACAAGCATTACGTCAGAGTGCAACTTGCACTGGAGTGAGGTTATCAACCATATATTCAGGAACAGGAACAGCGTCGATATTGCTGTCGT
GCAAATCTCACCGCCGTGGACTCGCACACATTTAAGTAATGCACCAAAACGTGGGTACTATTTATAGCAGAAATTGGTAGAAATTTATTGATATGGAAGA
ACATCATTGTAACGGGGTTACATGGTGTGGAACACACATACTCTCAGTACATAACTTGGAGAGTTAACAAGGTCTCTCAGTACGTTTTCTGAAAGCCACA
CGTTATGCATTTGATTAGGTTTAACTATGCTAGATACTTAAAGAGATATATTTACCCCTAGGCGGCTTTGCCGCAATAATTGTAAATAAGACACTTCTGT
TTTTTAAGCATAAAAGTTAAGGTATTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCCTTTGGATAAAGAACTTAATATTAGTGACTCTTAGAGTCAA
ACTTCTTCCTCTGACGCTAAAGCCACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCATGAGTCGGTTGACTATATCCTCTGCGAGG
ATGGAACACCCCGTGTTCGCGAATTTGCCCCTGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGTATGGAGGGCGTGGCTTATCTTGCAT
CGCAAGGTCTAGAGGCGCCCACCGCCAGGCTGGAGCCGCTCTCCCGCTACGAGAACGCGCTTTTGGAGCACGCCCAAGAGAAGATGAGCGCCGCAACGGC
GGCGGCGTCGATGACGCATGAAGAGTCTTTGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGCAAGATAGAGAAAATCTCCTTCTCTGG
GCCCGTGAGGTCGAGATGGTCATGGGATCGGCCCTGCTCCAGTCTCAGCATCGGCGCGTGGTGCTGGTTATCTCCAGGCTTGGCGGTCGCGCTCGCGAAT
GGGCACTAACGTGCGGCACGCCTGTTGACGCTGCATTTCCCACTTGAGATCCGTTGAAGCAACAGCTTTCGCGTGTGTTCGCTCCGCCTAATCAGGCGTA
CCGTATCATGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTTTGTCCAAGTGTTGAGAGCTATTATCGCCGGAATGGCGGCGGAC
TCTCTTCCGGAACTGGTCAGCGTGACCGTGTTCACGGGGGACTTCGTGTGAGCACAGCTCGAACAGAAGTGTTCCGTGTACACCCTAACGCTTTCGAAGA
GCCGGTGGGTGTGGCATTGAATGCCGAGCACAGCTTCAGGGCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGATCCAGAGCCGATG
GACCTCAGCTATGCTAAAGATGCAGAAGCGGGGCTTCTTGCTGTGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCGATAGGATTAAGCACTTGA
GGGCCTATTGCCCTCTTCGCAAGAAACGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAGCTCCCAGTAGGCGCGGTGCGACCT
ACTGGGAAAGAGCTAAATTATGTTGTGCCTCGAAGAGGTAGAGGGCAACAGGCTCAACTCCGAAGAGAGTTGAGCTCTTACAAGAAGAGTGTGTGCAAGC
CGGGCTTGCTGGTCGCTCAAGCGAACATGAAAGGCTTTACAAAGCCATGGAGAGTCTTAATTGACTCGGGAGCCTCGAGCAACTACGCCCGTCGCTCCAC
CCTGGAAGGGAGTCAGCTGTATGCTGAGGCACGATCTCTGTCCGTCTCGCGACTTGGACACTTGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGA
AGTTTGAGAATTTCGATAGCTTGGAACGC