Description :
From Genome Similarity Track
Location :
scaffold_65:49625- 51147
Sequence
1522 bases(100 bases per row)
GTGCTCAGCTcctgagcttggagatagctagcgccacgcgctgttgctagtTTTGGAGNNNNNNNNNNTCCGgtagcttttacgaccagcaagcccgctT
TGCTTACGGATCCCGTGTTCAATAGCACGCAGCTCTTTggagctgggccctgcttcCTTCTACCTCTTTtttggctcaacaaaactccgGTAGGGCCCCG
CGCCAGCTGGGTGCTCTCGTTTTCCCGCCTCAAACCAGATTGATGAGAAGCGGGGCGTCGGTTTGACAAAACTttacgcaccttgcgcacCGGACAACTG
GTTCGAAGATGTCGGGTGCCTCcagaaacaaaacaccgtcgggagTTTACAAGCAGCTCATCAGCTCGGCGCTCTtcctcctccttctcagcatagctaa
gaTCCATAGGCTCAGGCCGGCTCGttgagctctgagggtgtgtatttcaaccaagtcatgccgacttgaagttgaatttggtatttaatgccacgttcac
cgctttATCAGAAGAAGATGGCTGAACATATAggtcttccattctggcctcGCCAATGCCGAGGCCCCCATGAAGACAGTCACTGTAACCGCCTCTGGTA
GAGAATCGGCTGCCATTCCAGCAATGAGAATTCACAACTCTTGGATAAAGTTCATCAATTCCTTTTTCCCCTATCGGACGGTAAGGAAAGGCAATCGCAC
GCGACNNNNNNNNNNcgctctgagggtgtgtatttcaaccaagtcatgccgaattgaagttgaatttggtATTTAttgccacgttcaccgctttATCAGA
AGAAGATGGATGAACATATAGgtcttccattctgacctCGCCAATGCCGAGGCCCCCCATGAAGACAGTCACTGTAACCGCCTCTGGGAGAGAATCGGCT
GCCATTCCAGCAATTAGAATTCACAACTCTTCGATGAAGTTCATCAATTCCTTTTTCCCCTATCGGACGGTAAGGAAAGGCAATCGCACGCGACATGCCT
GGTTAGCTGCGAGAACACTCCAAGAAGCTGACGCATCAGCTCCTACTAGGAGGGGAACGCAGCTTTaatcgaagcaccgcacgttatgGACGATTCTTGT
GCTCAGCTcctgagcttggagatagctagcgccacgcgctgttgctagtTTTGGAGNNNNNNNNNNGGCACTATTTGTGCAAGATACATGTTGTATCTTG
CACAAATAGTGCCGTTATCACGCTGTACATGTATATTgtgcttgcagtagtgcacGCTAGGCTTGTTGCGCCATAATTTGTTTGTCCGTTACGAGCTGAA
CATCGACGTGAGTTTATGGGCGGGGGTGTCGCAATGCTTTTCGCAGGCAAGAAGTTGGAGGTAATCAAGCGAAAAAGCAAACCGTAGCGAGCGTCTTCTC
CTNNNNNNNNNNAAAGTTCCGTGAGACTCTTCCATCTGATGTCTGGACTTCTTCGATACTAACTCGACGGANNNNNNNNNNGACCCCAGTCCTGGGCGTT
TCTAACGCGTATTTTACGATAT