Description :
From Genome Similarity Track
Location :
contig_107:49624- 50755
Transcript NameFunction/comments
g13618.t1hypothetical protein

Sequence
1131 bases(100 bases per row)
AGGCGAATGCCAGCTGGCACCATGAAGTCCATCCCCAGGATCAGGTCTTGGCCGCCTGTGGGCGGACCAACCCACGCGTCGAAGTAGTACACCAGTGATC
CAGCGAGCGTGATCTTGATTCTGGTACGCCCATCCGCCATATAGGGATTCTTACCAACTCCTTCACATTCCAACTCTTGACTGTTGTCTATGTAGCACCC
AACCTTACGAGCAAAGGCGGCATCCAGAATGGACACCTCGGCGCCGCTGTCAAACAGCAATGTGGCTCTTTCGTTGTTGATCTTCCCCATGGCTTTCGCC
TGCCGGAATTTCTTGTCTGGCACATGGTACTTCCAATATCCTCGCGACTCTCCGTGCAGGAGATCCAGAGCCATCGTCACTTCTGATCGCGAATACTCGT
CGACTTGGTGGAGGCTGGAGATCGCCATGGTACGTTTGTCATGAAGGTCACATGTATTGTCCGTCGGCCGAATCAGCTTACTCACCTCTGACTTCGACTG
TTTTTCGACATATGCATAGATGCAGAACTGAGAACGCTCGTCTCGTACCGGATTCAAACCCGGCGAGCGTTCTAGTTTAACATCTTTTCAGCCGCTTGCG
GGAGCATTCCACCGTGCTTGGTGGGGTTGTACCATTGACGGATCAAGTTGTAGAACTCTTCCATCGGGCACTCTCCGGCTCCGTGAATCTCGCCGCAGGC
CTTGCAGACGAAGAGGCAGCGATCGGTCGGGTGGCCCTTCTTGCCACATTTCTCGCACGTCAGACGCTTCCAGCAACCAAGATCGGTGTGCTTCGACGAT
CCACAGTGGGAACATGGCTTCCGCGGGGCTTCTCCCTCGAGAGATCCGGCTGGACGATCGAGGCGACGGTCGTTGGAGTCTCGACTAGGACGGCGTTGCT
CCTGATCCGAATGCGATCTGGTCGGCTGATCGGGCGTTGCCGCGAAGTACACCTTGCGTAGGTCTCCTCACCCTCCGATCCGCTGGTTTCCAATTCGGAG
TCGCTCGAGTTGACTGTTGCGCGGATTGCGCGGACTGCGCGGCATTCGCGGATGGGGTGATCCCGTGGGTGATTTCTGCTTGGGTTTGATGGACCCATAC
ACCGTCTTTCCTTGTCTCGCCTTCGCACGTT