Description :
From Genome Similarity Track
Location :
Scaffold_1717:4962- 6589
Transcript NameFunction/comments
Phyta_totarag13549hypothetical protein

Sequence
1627 bases(100 bases per row)
GAACCTATTGTGGACCCCGAAGTCGACTTAGTCGAAATAACACTCGGCGTCGAGACCACCGCCGAGATCGAGGTTACAGATTGCGACGCCGAACCAGGTG
CCGAACTCGGTAGAGCTGGGATCGATGAAGGCTGGGACGACACCAGGTTGACTGGAGAATTCAATGCCGAAGCGTGAGAGGTCGGCGATGAAGTCATGAC
GGAGGTGCAACCCAGCGGAAACCCCTTAGCAGCAGGCTCAGAGGCATTGAAGTCAATGGACtcaacatcatcgtcatcagaTGGCTCCGAAGTCAGCGGT
GATCGACGAAccaagcgacgacggcgggATTTGTCTCTGGGGCGAGAACTGCGGGACCCCTCACCGTCTGTCATCGCACGCACTAGCTCGGGGTCGAGCA
GAGTCGTCGCTGGATCAAACCCTTCCTCGCCCGGCAATGGTCGAGCATACGGCATCGACGGCATGCTCGGCGAGCGGCGACGcggacctgctgcagtcgg
tGACTTGGGGTTCGAAAGCCGATGCAATTTCTCCGCGGAAGTCAGCGAAGATAACCGAGCTTGGCGAAGCTGGCCCGCTGTCTTGGCAGGCATTGGAGAA
GCATCGACCGACCGTGGCGCCGACACCGGAGCTGAGCCTGACGTAACAGCCGAGTCGTCCGAGCGAGGACGAATTgagagctcgacgacgcgagcATCCC
TGTCATGGACGTCCACCACTTCAGGAAATCGCGCCGCTAGCAACCGGCATAGCCGAGCGTTGAGTCGCAACTCACTCAAGTCGAATCCCGGAGCATCCAg
tcctcctgcagcagcggcagccatGTGCGGATCATGCATAGGCACCATCCCATTGTGATAAATCACCTGCTTTTGCCGGAGTATGGTAGCTCGCTGGGAG
TCGATGACGGTCTGAGCTTGCCGGAGTGCGtgaccaccaccagcggTGACCAGCCGAGCCGACCCttggtgttgctggaaaTGCTGAGTGGCGATCCCTT
GGAGAATGACGAAGGCTTGGTCGGGCTTAGTCAGCTCAGCGTACAACTCCTTGAGACTTTCATCCCGCTCAGCCACTTGCTTACGCATGTCTTCAACCAA
CTTGAACGCAGAATCGACCCGACTGCTGGGATTTCTGCgcctgctcaagctgagTAGTAGAAGTGGCGACAGCCTTGCGAAGCAAAGCAACGAGGCTGGT
AGTCTTGATCAACTCGGCTTTCCAGTGAtctcgctcagcttcgacCGTATTCAACTCGTCTTCCGCCTTGACCCGCGCAGCGATCACCGAGTCCATACGG
CGCTGATTCGAATGGTTGAGATACTCCACCACAGCGAGTTTGGCGCGGAGCTCTGCGAGGGAGGCGTTGAGGTCAGGGAGAGCATCATCCCCGCGCAGAA
TGTCCAACACGGCTCCTGGCGACTCGGCTTGGAGGAGTGCGTGCCTCTGAACGGGGTCGGATGCAGAAGGGGGGCGCGTCAAGCTATACGCGATGAGCTG
CGTCAAGTTCCGGCTATCATCGGAGCGAAGCCGAGCTTGCTCAACGACGAATGCctggaaggcagcagcgtctggtGGTGAACCAACAGCGGAGGCACAT
ATGCCAGAGCTCAGCGAACTCGGCAAG