Description :
From Genome Similarity Track
Location :
Scaffold_125:4961- 15132
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_125-fgenesh-gene-0.0P-type ATPase (P-ATPase) Superfamily
Pytap_DAOMBR444maker-pag1_scaffold_125-fgenesh-gene-0.1Major Facilitator Superfamily (MFS)
Pytap_DAOMBR444maker-pag1_scaffold_125-fgenesh-gene-0.8Acetyl-CoA acetyltransferase
Pytap_DAOMBR444snap_masked-pag1_scaffold_125-abinit-gene-0.52Conserved gene of unknown function

Sequence
10171 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGGGTGACAGTTCTCTGGTGATGGAGGGGCTTGAATTCCGCAcGCGAGTTCTCGATGGAAGCGGCAAT
ATCATTCAGAGCGAGTTCGACAAGATCTGGCCCACGCTGCGAGTGCTGGCGCGGTCGTCTCCTAAGGACAAGTACACGCTCGTGACTGGGCTCATGCAAT
CGAACATCGCTCAGTATGGCCCTCAGGTCATTGCTGTCACAGGCGACGGAACCAACGATGCgCCTGCGTTGAAGAAGGCCAACGTCGGGTTCGCTATGGG
TATCAGTGGCACTGCAGTCGCGAAGGATGCGTCCGACATCATCTTGATGGACGACAACTTCACcTCAATCGTGCAAGCGATCAAATGGGGACGCAACGTG
TACGACTCGATCGCCAAGTTCCTGCAGTTCCAGCTCACCGTCAATGTCGTGGCTATCACTCTAGCGCTGATAGGTGCCGTCGTGTTGGAGCAGTCTCCGT
TGACGGCCGTGCAGTTGCTGTGGGTGAACCTGATCATGGATTCGTTTGCGTCCCTGTCACTAGCAACGGAACCTCCGACCCAAGCACTGCTCGAGCGGAA
ACCGTACCCGAAGACGAAGCCACTGCTGTCCAAGAAGATGCGCAAGCATGTCTTTGGGCAAGCGATATTGCAGCTCCtAATTCTGCTTcTGCTCACGTTC
TATGGAGACAAGATGTTCGACATCAAGTCAGGACGCTTCAAGGACCTCACAGACGAAGAGAAGCAGGAgCCGTCCATCCACATGACCGTGGTGTtCAATA
CGTTCGTGTGGCTCCAGCTCTTCAACGAGATCAACGCCCGCAAGATCCATGACGAGATCAACGTGTTCGACGGCATCATGGGCAACGACATCCACCATTA
CGTGACCGTGTTCCAGGTCGGCATGCAGATCATCATCGTGCAGTtCACAGGCAAGTtCTTCAGCTGCGCGCCGCTGGACGCgAaGTACTGGGGCaTCTCC
ATCGGACTCGGCGCGCTGTCGCTGCCACTCGGCCTCATTCTGCGGCTCATCCCGACGGACGAGTagCTCCCTAGCGTAGCCACTTGTATCTTtagAACCA
GTCTGTGCAGGGTATTTATAGACCAAAACTGGATATCAACTGTGTTTtAACCaTGCTTCAACCCTGAGACCTGATACAGCCAGCCGATGGTATACAATTG
TCAAGTgTGTAGTTCCCCCTGTCTCAGTAGACTCGATTTAGCCGTGATCGCCCTGATTTTTTtCcATGAATAAAGTCCCTCTTCTTATCACTATTTCCAG
CGGCTCGCTCGCCTCACATGTGCCGCCCCCGTGTCATGAGACGCGAAACGACGCATTTCGCAATCGGTGCGGACAGGAAGACGCGGGGAGTATGAGCGGC
CAGTTCAAGCTCCTGGCCAGCGACCTCATCCGGCTCGTGGAGACgCCGCACGAGAAACAGGGCGAGCAGCTGGCCAGTCTGGGCGGCATCGACGGCGTCG
CGGCGGCGCTCGGCGTCGATGTGCGCCAAGGGCTCGACAACAACAACGCCGCCGACCTCAaGAAGCGCGAGGACGCCTTCGGATCCAACTaCATCCCGCc
GCCGCGCGCCAAGGGACTGCTGGAGCTCATGTGGGAGGCGTTCCAGGACCTCACGATCATTGTGCTCACGATCTCGGGCATCATCTCCATCATCCTCTCT
GTCACAGTCGGCGATCACCCGGACACAGGCTGGATCGAGGGCGCTTGCATCATCTTTGCagTGTTTGTCGTGACATTTGTCACTGCCGTGAACGACTACC
AGAAGGAGCAGCAGTTCCGCTCACTCAACGCCGTCAAGGACGACGAGAAGATCAAAGTCATCCGGAATGGCGCGCCGTGTGAAGTCTCCAAGTACGGGAT
CATGGTCGGCGACGTTGTGCGTGTGGATCTGGGtGATATTGTGTGCGCCGACGGCATCGTGTTCGATGAGAAGGAGCTGAAGCTGGACGAGAGCGCCATG
ACCGGCGAGTCGGACTTGCTCACGAAGAACAAAGAGAATCCTTTCCTGCTATCGGGAACAAAAGTGATGGAAGGCTTAGGCAAAATGCTGGTGATTGCcG
TGGGCGAGAACTCACAGGCTGGTATCATCAAGAAGCTGATCATCGGCAAGGGCGGAGAGAAGAAGAAAGAAGAGAAGAAGCAGACACCAGCAGCAGCGAC
GacaGATGAAGCGGCGGTCGAAGTGGTGCCGCTTAAGAATAACGGAACAGTGGAGCAAAAGGAGGACTACGAGGAAGATCACCCACAATCTCCTCTCGAA
GCTAAGCTATATCGGTTGACGATTCTGAtcGGTAAGCTCGGTACAaCAGTCGCATTGCTGGTCTTCTTCATCATGTCGATCCGGTTTTCGGTCCACAAAT
TCCATGAAGACAAAGAATCGTGGGACAACAAGTACATCAGCGACTACCTCCAGTTCTTCATTGTTGCGATCACAGTGCTGGTCGTAGCCATCCCTGAGGG
TTTACCACTCGCGACCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAGGAGACGGcGCTCTGGTGATGGAAGGTCTCGAGTTCAGAACTCGGgTGCTC
GACGGACGTGGAAACAtcATTCAGAGCGAGTTCGACAAGATCTGGCCGATGCTACGCGTCTTGGCACGCTCCTCACCGAAaGACAAGTACACGCTCGTGA
CTGGTCTCATGCAGGCAAACGTCATGcctCATGGTCCTCAAGTCATTGCGGTGACCGGAGACGGAACCAACGAcGCACCAGCGTTGAAGAAGGCCAACGT
CGGGTTCGCTATGGGTATCAGTGGCACTGCAGTCGCGAAGGATGCGTCCGATATTATCTTGATGGACGACAACTTCACCTCGATCGTGCaggccATCAAA
TGGGGACGCAACGTGTACGACTCGATCGCCAAGTTCCTGCAGTTCCAGCTCACCGTCAACGTcgTAGCGATCGCGCTGGCGTTCTTAGGCGCGATCATCC
TGGAGCAGTCGCCACTGTCTGCAGTTCAGATGctGTGGGTGAACCTGATCATGGACTCATTTGCGTCTCTCGCGCTGGCAACAGAACCCCCTACGGCAGC
TCTTCTCGAACGCCGTCCGTATCCAAAGACGAAGCCACTCCTATCGAAGGCGATGACCAAGCACATCCTTGGACAATCCGTGCTGCAGCTCGTCATTCTG
TTACTCCTCGTGTTCTTTGGTGACAAGTGGCTCGATGTCGACTCAGGTCGAATTAAAGATATCCCCGAAGACAAGCAGCACGAGCCGACAGTCCACATGA
CAGTAGTCTTCAACACGTTCGTGTGGCTTCAACTCTTCAACGAGATCAACTGTCGAAAGATCCACGACGAGCTCAACGTCCTGGGAGGGATCATGGGCAA
CCACGTGTACGTCTACGTCACGATCTTCCAGATCGGCGCCCAGATCCTGATtGTGCAGTTCACTGGCAAGTTCTTCAACTGCAAGCCACTGAACGCAGCT
CAATGGGGCATCAGCATCGGCCTCGGCGCCATCTCTCTTCCTGTGGGCTTGGCCCTGCGGTGTTTCTCGGCTAAGCGCTTGCCATCATGGATGGCGATCT
GCCAAGAAGCCGACGCCGTGGAAATCGCGaCcGTGAGGAACCAGAAGGCGCACGcTACATGGCTGCGAGGCTTCTCCCGCCTGCGGTCCCAGATCAGCGT
AGTCAAGGCCTTCCGCAAGGGCCTGGCtGCCCAGGCCTCCATTGAGCAGTGATCATCGAGTCTGTCCTCCCAGTTTTGACGCGCTCTCTTCTTTTtCTCT
TATTtcGAATATAtcATTTTTCCACATCTTCTGTATCTGAATCTGAGAAATGCTGGACTCAACAGTTGGCACGCTCAGTTACGAACCGgCCTTCTGGTAC
ACTGTACCATCTGGGCGGTGTGTCGCTTGGTCAGATCCTGAACGGGTCCCAGACACTGGCGCAGGAAGCAGACGGCGGCGCCATCGAATCTCTAAGGGCG
TCTGTCGCATCTGCCTCCCGTCTGAACGCCCCGCTTCACGCCCATCCCTCCATCGCGCCACTTGCGTATTCGCCACCAGCGGCCATGGTCCAGTTCGCCA
AGAAACTCGCGGCAGCGCAACGCCCAGAATGGAAGGGGTaCGTCCACAGCAGAGACATGGATGCGACCAGGACGAGGAGCTAAGTGCTGTGTGTCTAAAG
CCACTACCTCGAGTaCAAGCAGCTGAaGAaGAAGCTCAAGACCGTGCTGGCGTCTACGCGGGATCTGCACGCAGCGCCCACGGCGGCCGTGCAGGACGGA
TTCCAGCGCGCGCTGGATTCGGAAGTGGAGCGCGTCGTGCTCTTCTTCCTCACCAAGCAGGGCGAGTTCGCACGCACGCTGGCTGAACTGCGTCgCGAGC
AGTCGGGCGTGCTCATGGCGAGTGATGTGGAGGCCATGCACGCACTCGCCGACCGCTTCCGTAAGACtGGGGgACGAGCTTGTGCAGCTGCTACACTACG
TCGAACTCAACGCCACGGGCATTCGGAAGATCCTGAAGAAGCACGACAAGCTCATGAAGGAGCGCAAGaTCATGGGCTCGTAtcTGTCCTCGCGCACGGA
CTCGCAGGCCTCGCACCTGCAGCAGCTCTACCATGACGAAGGCATCTCGGCCATCATCGCGACGATCCGCTCGGCGCTTTCCGATTTGCGCAAACTCGAA
GTGTCGCTCGCCGCCGAGACCACGCAGCGCTCGCTGGCGCGCACGATCTCGgAGGACGAGCCAGTGCTCAACAAGATCGCACTCGCGCGCCGCCGCCTGC
AGCAGTCCACACAGTACGTCAAGACCATCGCCGCGCAGGCGCTGATCTTCGATGGCGAATCATCCGAGGATGAAGAAGAGGAGGGCTACACATCTCTGCG
GCCGCGCATCAAATCGTCCGAGCTGTCGCGATTCATCAACATGACGTGTACGTTCCTGTACATGACCAACTACTACATCGTGGCGCCAACAAGTGGCGAC
TACGCCGCTGCCCTCGGTGGCGAGGCCGCGCTTTCGGGTGTGATCGTCGGTATGACGCCCATCGCATCGCTCGTCAGTGCTGTGCTCTACTCGTGGTGGG
CCAACCGCTCGTACAAGGCACCGCTGcTGTTCGCGACCGTGTGTCTCGTGGTCGGCAACCTGCTCTACGGCATCGCGCTCTACTACAACAGCATCGCCAT
GGCCATTACGGGCCGTCTGCTCAACGGTTTTGGTGGCGCGCGTGCCATCAACCGCCGCTACATCGCCGACAACTACTCGCGTGAGGAACGCACTCAAGCG
TCGGCCATGTTCGTGACCGCCAGCGCCCTGGGTATGGCTGCCGGTCCCGCCCTGGCGGCAGCGCTCGATTACGCGCCTGACTTCACAGTCCTGGGCGTCC
CCGTGACGACCGAGACAGCCCCTGGCTGGGTCATGTTCGTCTTCTGGACGCTGTACTTGGGCGCGACCGTCGCGTTCTTCGAGGAGCCAGTGCGTCCTGA
GCGCATCTACCGCATCGGGAACTCGTCTGTCTCGCTCGAGAGCGGCATGGCCTCCGAGACGACAGCGCTGCTCACGCCTGGCGGCTCGTCCCACCAaAGC
AAGCACCCACCTCTCTCGTCTCTGTGGCGCAACGTGCCAGTGGTGGCGACGCTCGTCATCTACATCGTGCTCAAGCTCGTGCTCGAGTGTCTGCTCACGT
CCAGTTCGACGGTCGCGCAaTTCTACTTCCAGTGGAACTCGATCGACTCGGGTCTCTACCTCGCAGCGCTCGGCCTGCTCATGTTCCCGACCAACATGAT
TGTGAGTTGGCTCTGCGTGCGGTACGACGATCGCGAGCTAaTCGTCCGCTCGGAGATCTTGATGCTGGTCGGCGTGGCCGCCATCGTCAAGTACACGCCC
TcGTACTCGTCGCTGCAGTTCATCATCGGTGGCGTGCTCATCTTCATCTCCACTAATGTGCTCGAGGGTGTCAACATGTCGTTGCTCTCCAAGACGATTC
CGAAGTCGTTTGCACGTGGCACGTTCAACTCGGGGCTTCTCGCGACGGAGGCTGGCACGCTGGGTCGTGCCATCGGTGACGTGGCAATCACaGTCGTCGG
TCTTCCTGGCATCCAGTAtgTGCTGAACTGGAcGTTcGtACCGCTTGTGCTCACGAGCGGACTCACCATCctctacacgcttcgcgtctacagtaagcNN
NNNNNNNNNNNNNNNNNNTGACTAGACGCTAGGAGGTTAAGATAAGACCGAGTAGACGATGCATTCATCTAGTTAGTGAGTCGCTACTCCCGCTCCAACA
CCACAGCCGACGCACCGCCGCCGCCATTGCACACAGCTGCACAGCCGTAGCGCCCGCCTTCCTGCTGAAGCACAGACGTCAGAGTGACGATGATTCGTGC
ACCAGAGCAGCCCAGCGGATGACCGATCGACACGGCACCACCGTACACGTTCACCTTGGACGTGTCAGGCAACTCGAGCAGCTTGCTATTAGCCACGGCC
ACCACTGAGAACGCCTCGTTGATCTCGAAGAAGTCGACATCACCAACAGTGAGGTTGGCGTGGgCAAGCGCCTTGGGGATGGCGAGGGTTGGCGACGTCG
TGAAGGCCTTGGCGTCCTGCTCAGCATCAGCGAAGCCGCGGACAACTGCGCGGATCTTGGATTCGAGTCCCAGCGCCTCGGCCTTGGCTCGACTCATAAG
GACGAGCGCGGCAGCGCCaTCATTAATAGTCGAGGCATTGCCAGGGGTGACGGTAGCACCAACGGAGCTGTCGCTGGGGGgCGTGAAGCACGTGCGCAGC
TTGCTCAAAGTGGCGACGTTGACCTCGCGCGCCACGACCTCCTCGTCCTCAGTCACGACAAGCGTTTCCTTGCGCGTCTTGACCTCCACAGGCACGATCT
CGCTCTGGAACTTGCCCTcGCGCGTCGCTTTAAGTGAACGGGCGTAGCTGTCCGCAGCGAAGTGGtCTTGGGCCTCACGCGTGACGCCGTACTGGTGAGC
GCACGCCTCTGCCAGGTCGCCCATAGGGATCTTATCGAAAGCATCCACGAGGCCATCCTATAAACAGAGAGAGAGAGAGATGAGATTCATGCAGAATAGC
AGATGCAAATGGCCAAGAACTCACCGTCTGAATGGCATCCGTGAAGACGAGCTCACCAAAGCGCGCGCCAGTTCGCGCTTTGCTCGACAAGTGCGGCGCC
TGGCTCATGCTCTCCATACCTCCAACGACAaTAACGTCACGCAGACCAAGCATGATGGACTGAGCACCGAACATCAGCGCTGTACACAACTCAAGACATG
AGTGCAGGCAGACCAACGCACCCaCAGCGGCATCAAGAACGCACCTTTCATGCCTGACGCACAGACTTTGTTGACCGTCGAGCacGGCACCGTGCTAGGC
AGTCCTGCACTCACGGCGGCCTGCTTGGCTGCAGCCTGGCCCACTCCGGCTGACAGCACGTGGCCGAGGATGAGCTCCTCGACGTCCTGCGGTGCGACGC
TGGCACGAGCGAGAGCCTCGCGGATGGCGACGGCGGCGAGTTGCGGGGCTGTGAaGGTCGAGAGTTTGCCCTGGAAGGAGCCGACGGGCGTGCGGGCGAc
GCCCACGACGCACACGTCGCgCGGGCTCTTGGTCATGGCGGTGCGgAGGCGCTTGGCCGGAGGGCAGTCGAcgCCGAACTGCATCACGCGTGTTGTGTCA
GAGAGCGGATCGtGATGACGAGCCATGCGGAAGTAACGATATGAAGTAACGAGCgaTGTGATTGGTGGAAACGCGCAGCTCAAATTGAACTTGtGGAGAC
CGCCGatGATTGGGTGGGAACATATTGGATCTGAtAGCAAATAGACCCATACAAACGCCAAGACAAACGAGAGAAAGATCGTGGgATGCCCCAAGCGACG
CCGCTTGACGCGCATTTGTCGGGATGATGTGGCTGTACGTCGCTCTTGCGCTGCTGCTGACGCTGGGCCATGACGCTGAGGCTTCGTCAATCGTGTTGCC
GATGTTGCTCGACGTCCAGCCCATGGTGTTGGCCATCGACGTCGCGTCGCCTGTGCCGATTGACCGACAGCTCAATGCGTTTTGCTCGCgCCACTTGATT
GTCAATGGAAGATGCCACGTGCTCTCCGAGGCTGTCGCAGAAATTGTTCAAGCCCAGCGCGCTGCCCAGGCTAACTGTCGACCAAACTCGGAgCCCATCG
ATGTCTCCTTCGCGCTGGTCAAGAATGTTCTCGTCTCTCCGGATGCACGCAGTATGACGACGTTCAAATGGATGAAAGATGCACCACACAATATTGCAAT
CGATATCTGCCAGTTTCTGAAAAGCCAGGCATCGTCAGGTGgAGACGCGTCTGTCCTGGACGAGTGCGAGG