Description :
From Genome Similarity Track
Location :
contig_45:496096- 504725
Transcript NameFunction/comments
g8155.t1hypothetical protein

Sequence
8629 bases(100 bases per row)
AGCATGGCCACGCCACGTGCAACCCAGTGGGCCTCTGGTCTGCTGGTGGGCAGCCGAATGAAGCAGATGAAATTCGTCGAGTGGCCGGTAGTCGACAGCG
TACCTCGTCGCTCGCTGCAATCAAGTTAAATACCAAAGTTAGGATATCTCTGTTGCAGGCGACCAAATTGACACAACCGACCTGGTCTTATATACTGGGC
ACGAGTACGAGCTGCGTTGACTCATGTCGGTCTTCTTCACGGGGTTGAAAAGCAGCACAGGCGCCAAGGAGAACAGCACCTTCGGGTCTGACTCCGCCAG
CTCACTCGTCGCCTTGTCCCATTTGGCGCCTTCGAGGAACATCCCTCGAACGTACACTCCATCCTGATCATAAAAGTTTGTAAGCTTTTCTTACCTATTC
AACAAAACCTGCTACGGGTGGCCGTACCTTTGGTGGCTGCGCGTAGTCGTTCCGCGGCATGGGCTCGTGGTCGAAGCCCAGTTGGTCAATGGGCAAAGTG
TACTTTCGCGCGTAGTTTTGACTGGCACCCGTCAAGAACGCTTGCGTGAAGAAGAAACCCGAGATCCAGAAGACAACTGGCGGCTTCTCTAGCAGCCACT
TGTTGAAGAAGGCAATGCGCTCCAGCAGGTCAGTCACGTAGCTTCCCAACGGCTTCAGGGAAGGGTACGACTTGGACGCCCAGAGTGCTGGGATCTTGCC
GTAGAATAAACTCTTCGAAACATTTTCGAGCTCTGCCGACATGACCACGAGGCCCTTGAGTGCCTTTTGCAGGCTTTCGAGACTCGATCGGATTGTGGAC
ATGAGGTTGTTAAAGCGAACGAGTTCTTGACAGAGCACCGTGTTCATCGACTCGTCCCAACGCACCGGGTAGCGGATCTGTGCCACCTCCATGTCAAAGT
TTGGCGGTAAACGCTGCAGAATGTCGTTGGCCACGGCCTCCACGAGCTCTTCTTGTGACCCGCTGCTACCTTCATTACCGCCCCCTGAGCTCTGTGTAAG
TAGCACGTCGCGACATAGCTTGGCCGTTGCGTTCTGATCTTTGGTGATCGTGGCGTTATCATGGAGCCCAAACACTCCAGGAGGAGCCGCTAAAGGCAAA
CCTTCGATGAACTTGAGGTACGAATCGTAGTCGCCATCGGGTGGCATTGTGTACATACCTTGTTCATCGAAGGCGTAGCCCTCTTTGAAAACATCCAAAC
AGTAAAACTTGCCCAGAACAGACATGAGCGTACGGCGATCTTTGTCGTCTGTCACACGTCCACCGTAGTTACACTCACCGGTGCAATAACGCAATGCGCG
TAAGGGTAACTGCACGTTTTCATCGACGAACATGGCCAATTGGCGAATACTGATGCTCAGGTCAGACTCGTTGAATTCGTACTGAATATTCCAACCAAGA
GGGCCAAATTGCCGACGCTCGCGCACCAAGGCGTGGAAAAAGCACAGCGAGTAAAGAAGCACGCGGAACTCGGGGCCTTTGACCACGGATTCAAGGAAAC
CCTTCTCACCTACCGGGTCCGACATGTAAGAACCCATGAGATTAGCTCGTAATCCTTGCGGTGGTTCATTTGTCATCTTGACACCATTTTGCAGGACGGC
CGCTGGGAACACGTCCGACGGGTACGTTGTGCACCACAGCCGGAAATCTGGGTGCGTATTGTCTAGTTTAATATCTTCAGCAATCTTTTCCATCACAGGC
ATCCAGCTTGGCGCTAAATGGCAATTCTGTAGTACAACCCATGAGCCGGCCTCGCGAGCGCGTACAATCATGCGCTCAGCGATAGGACCTTGACCTTGGC
CCAGTGAAATCGTCTCCGCCTTTTGCCGAAGTGAGTCCGCAAATTTGAGCACGGAGCTGATCGGGTCTGATCCCGGCGACAAGATGAACACTAATGGCGA
TGAAACGCTGCTGTCCGAGTACGAAAGAGCCAAGTCGAACTGCGGGGGCTTCACGAATTTTTCACCCATTTCCTTGACGAGGAACTGTTGGATTCCAACG
ACTAACAGGTCGGGACGGATGCATCGTAGACTTAGGAGTCGACGGAACTCGCTTACTCGCCCCAGTGTCGCAGGGAACGGCAGTGTGTGGCCAACTGGAC
TATCGTAGACCGCCTTCCACTGGTCGTCATGGTCTATGAACTCCTCGATGATGCCATCGAATGCTGGTAGCGCACTTAACCTCGAAAATTCCGCCCACTG
CTTGTCGCTGAGCCACAACTTAGCAGGGTTTGGTGGCGGCTCGGAGAGTGCGATACCTCCAGTGAGCAAGAAGTACCACTCGCTGCTTTCGATCTCGTGT
TTGCCTTGTTTAATAGAAATGCATAGCAGAAAAGAAAACATGAGTTTGTCCTTCTCCAGCAAAGAACGGCAAATGTTGCGGTACAGCGAGTAAGTGAAGT
GGGCATCCAGATTCTGAAGTCGCTGGGTCAGATCCGGTGATCGATCACTGTTCAGGATACTAGCGATGAAGAGATTGATGAACCACGATAGAGAGTACTG
GTAGACGGGCTCAATGTTTGCAAGCTGATCGATGCAGAAGAAGAGCACTTGGCTTGAATAAGCCACCGGTTTGTATCCCTGTCGAACTGAGTCGATCTCC
AGCTCTGTCTTCTCAGCAACTTGCTGCTCCTTTTTGATCTCATCGGCGACTTGCTTACTCTGGTTCATGGTGTTGATAGCGTCTTCATCTTCGAGGATGT
TACCCTGTGACGAAGATAAAATGTTCAGAATCTTGTCTTCGATTTCCTTGAGCAACCCCTTGTTGCGTGCGTTCTGCACAATCAACTTGTTCTTTTGCTC
TTCTAGATCAGGTCTTTCCTGCGCCACAACGATTCCCAAGAGCTGGTCTTCAAGACCGTGAGGCGTGATCATAAAGTTCAAAAGCGTCACCTTCACTGAT
ACCTCTGGCAAATAGTGCGGGTTCCGATACTTGGTCGTAATGTAGAAACGAAAGCTTTCTGCATATTCAACGGTTGAGTCACCGAGACGAATACATGTCA
CCCCACCCTGTTTGAACGTTTGTTTTAGTAAAAGTGGCTCCAGTGACGGGTCCAGTTCCTCTGCAACGTTTTCAAGCAGCACGGGTGTGCCAAACTGTAC
TGAGTTCTCTAGAGTTCGCATATAGTCACCATCCGTTAGCTTAATCACCGTCATTTGGTTGTCCTTCTCCATATTACGGATCCATTTGTTTGCTTGGCCC
TGCGGATCAATCATCAGTGGCCATCGACGCGAATTGAAGACAATGATGCCGTTATCAACGGAAAAGCCGTCGGTCGGAAGTCCATCAATGTTCCACTTGC
GGATTTGTACCGCGTCGCCAAGAGATCCGTTCAGTGATGGCAGGTCACTGCAAGGAATGTCAAGCTGCTTGCAGCGTGCAACCCAGTCGTGTACGGCATC
CTGGCGGTATAATGAAGTGAATGGACCGAGATACGCAACAACTCCTGCTGAGATCAGCACGTCTCCTGTCAGTCGGCTGTACTGGATTGCCAACTGCTCT
GCAAACTCAGTCCAGCGTGTCTTTTCTCCCCCAAGGCTTTCGATCAGCGTGGATGCTCGGACAAGCTTTTTACCCGTGAGATCCACCTGGTACTCGAGGT
TTTCCTTTTGCTTAGTGGCGGAGTCAAACTGCCGCTGTAGCTCTGCTAGCCCGTCCTCAACCTCTTTCAATTGTGACAACTTTTCGTTCAGCTTTTTCAT
GACCTCGTCAAGTTGCTGCTCAGCTTCCTTTAGCGCTTCACGCTTGGGCGCAACCACCTTTGAAACGTTGTCGTACAGTGCCATAGCGTGCACCCATTTG
CACAGGCCTGCTGCTGCTTTTGAGGCCTTCTCAGCCTTTTCTGGACTGAAATTTTCATCGGCAATGCTGTTGACGATTTTCATCGTTTTGGGGTCGAGAT
TGTCCTTGTCGAACTTCTTCAACGTGGTGATGAAGGTCGGGTCGCTAAGCATTTTCTGCGATGGCCCCCAGTAATCCATGATACGCTTAGAAGGGTCTTG
CGGGTCTGGAATACGGGCTGGTTTGATACCAAGCATCACACAAACACCCTCGCACACCAGTTTCACACCTGCAGGAGGATTACTCATGGCTTTCACCTCG
TTGATCTCACTTGGTTTGATAGTATCCAGGGCTTTTAGAGCCTCTTCCAGTGCTGGAATTGCTTCCGCTAGATCTGCTTCCACACTGGCCTTCTGCTGCT
CGCACTCTGCCTTAGAAGCGTCGGCCACTGCAACATCAGCCTGCACTTCACTTCGCTGCACTTCAACTCCAGGCAACTTAGCTTTGATTTCCTCCATCAA
AATGTCTGTATCTTTCTTAGACTGGTCCAGCACAGGTTGCAAGTCTTCGAGCTCCTTCCGCATCACCGCCACATTGTTTTCTGCAAAATTGATCTTCTCG
AGACCAATAACATAGCGATTGCGAGCACTTTGTACGGCTTCACGACGGCGCGCCAGGAAGCTTTTAAACGCCACGATGAGCTCTAAATAAGAGGTCGGGT
CACGTAATTCTGGCGGCGCAAATTCTTTAGGAACTTGTCCGAGAGTTCCATCACGCTTACGTGGAAGTATTGGCATGTGTCTACAATGGCTTTGCGAACG
TTGGCGCTGTCCATTTCCACGTCTGCTAAGAATTTTTCGGCCACAGCCACCAAAGCATCGGACGGCCACGCAGTGAACCAGTCAATCGTACAACAGTTAA
TTAGCGATGGAAACTTTCGTAGTCTGTCCCTGAAGGCATCGCCGATGGGGGAGCAAGCGAGCACAATGTGCAAGTTACTTCGCACTCGCTGCAGGAAAAA
TGCATATAGCTGGGTTTGGTTCATGTTGTCTCCCACTGCTTTACCGAGTTTTTCCTTTACATGGGGGCGACAGCTTCACAGATACCGACCCGTTCGTCAT
ACGGGAACAGATTTGGAATCTCTCCAGAGTTCAGCATATTGTTAATGTCTTCGACAAAGCCATCATACTTGATCTGCGTATCGCTAAACAGGAATACAAG
TGGTCGCGCACCCGTACCAGCCATACGTAAGACATCCTTCATATCTTCACGCCATTCCGTCATGGTATAGTTCTTCGAAATTTCAATCTGCTTGATTTCA
AAATCAACGATAAACGCCGACAGCCGCGTAAGACTTTGACGACCACTGCCACCCACGCCAACAAGAAGTGCATTTCCACCCGGCATGTTCAGCACGCGAA
CAATCCGCGATAGGTGTTCGATAGCGAACAGAAACATAACCAGGTTCATGGGTTTCCGACTAATGCCATTGTACTCGGCCAAGTACCCGTCAAGACACTG
GATAAGCTGCGCGATACCGTCGAAATCGGTGTCCAGACGAACATCCACTTCTTTGTACAGCCTTGGACTTGCATCAGGGTCCATGTAGTCGCCAAAGAAC
AGGTTTCGCATATCAACTGCTGAGACTGGACCTTCACAACCGCGTTTGAGGCTAGCAAATACCTTGTCAAAGTTCGTAGCAAAGTGCTTGATAGTGATTT
TCTTCTGCACGTCGTTAAACCACTCCCGGTCTTCATCGTCGATCAAACGGTCACCGATCACGCGAAGGATTCGTGCACCCACAACTTCACCAAGCTGTTG
GCATTAAACTGCTCGCTAGGCACCACAAGCATGATTCCTTGGACGATTCGAGAGAAATCCCGAAGGTTGAATGTATAATGCGACTTCTTTGGAGTGGGGA
GGAGTGCACTCATAGCAGACTGATACAGCTCTAAAGTTGCAGACACCACGGCTTCTGAGAGGCGTTTCACCTCCGGGATGAAGGGATTTGAGCCAAAGTA
CCAATCCAAAATGGTAGTGAAGATACGCGTGAGTGTCGTGTCATCGAACTCGGAAAAGCACAGAAGGTTGAAATGGCGAAGTAGCCGAGGAGTGACGCTG
TTTCTTCCGCCACCAGGTGGTCCCATCGCTGCTAGCACAATAGTGTCAACAATCTTTCTCCATGACATTTCTTTGAGATCGTAATAGCCTTCACTGTCTA
TCAGCTGCCTCACCAATTCAATAGGTGGCTGAGCACCGTACGTTTCGACTAATGGCATATTCAGGTCGTCTACGAAAATAATGGCGTTCTTGCCCAGGGG
TGGGCCGAACACACCCTTGCGGCGCTTGTCGAGCTTTCCGTCGATAATATTCTGGGTCATGTTTGCCGACGTTTTTGCCGAGAACGACAGCATAATGACG
GAATTGAGATCCTGAGGCAGTACCTCGTTCAGAATTGAGGTCATGTAACAAGACTTGCCCGTTCCTGTTGGGCCACAAACAAGCACCTTTCTTTTGTTGG
ACACGAGAAGCTGAACGAGATACTCCAACTGAGCGGTGAAGATTGTTGGCACAACAATTTGGTTGAACGGCGTATTGGGCTGAATCACGTATGGTTTGAG
CATCTCCTCCCACTTGAACCACTTGCTCTCTTCAATGTCAAAGTAGTAGTCGTGCAGGTTGCCCTTGCCAGGCATTGGAAGCGCCAGTACGTACGTGTTT
TTGCTGTCTTCAAACGCAGGCTTCTCCCACTTGCGAACCTGAAGTGCACGGCTTACAACAATATACTTACTCTCCAGTGCTTGAATATTCTCCATAATTG
AGCGAACGAACTCACAAAACCTGATTCGTCCTTCAGAATTAATGCTCTCACCAACAGACCACGTGAGTGAGAACATGAAGAGCGCTTCGATCATCGCCTT
TTTCTTGGACGCTGCATCTTTTGGAAGCTTGCACAATTGTGCCTCAAAGATGTGAATGAGGCTTTGCACAAGGTTCGTATCCACGGTCGGAGACAGCTCA
ACTAACTCCTTCCTAACAAAAGCAATGCATGGTTCGACGAGCCATGAAAACAGGAAGTAGATGAGGCTCCGCTGGTCATTGTTGATTTCAAACGGGCCCA
AAGGAGGTTCCTTGGTACCTTCCACCAAGGTGATAGAGTCCAGCCATGAATTGAGGACTGGAATCCAGCCCAGTTGCTCAGGCTCCATGTAAATCATGCC
ACAGCGAGACACTGTCGCAGGTGACGCAACCAACAAGTCCATGGGTTCAAACATCATGCTCATGACCGAACTCATGGCAATAATTTCCCCGCTCATCAAA
CACAATTTGCGGTTATCATCAAGCACAGTATTCATGTTTTCAATCCATACAGCATCCACCGGTCCATCAAACATTAGCCACTTGCGATCTGGTGAGGGAT
TATTAGCCAGATTTCTGTAGTTAATGGCAAGCACTCCATCATTCCATTCGTGAGAAACGGCATCGAATTGTCCATAGAGCTGCCCCATCGTTACCGACTT
GGGGTTGATCACTGACACGATAACATTGGTATACCGTTGATCGTTAGGAAACTGCTGATGCAGATGAGCTAACACTTCAGACAGCACTCTCCACGAGCAC
GTTTTCCCTGAGAATGGCATTCCCACCACCATGAACCCGTGTCGCACAATCATCATTTCGTAGATTTTGAATCACCTTCTCGACAAAGTTGGGAACTGGT
TGTAGATTCATTTGTTTGCATATATGGTCGATCGAGCTCAGCATGTCTCTCCGATCTGGTGGATCGATCGTCACGCCAGGGAAAAGATCCGATACAATAC
CATTAAATAGAGGTACATCGGGGGACAAGAACTTCGGCAAATTGACGTCAATGATCGATCGCAACACTAGAGTATCTTCTCGCAGATGTCCTTCGGCTCG
TTTCAGGTTACCAGCAGCTCTAAGCACAGCCATGACAGCTCGCATCCCGTAGTCGTAGTGAGATTGAGATGACAGCTGTTCGGAGCACAATGTGTAGGTC
GTCGTAATCTTCTTGGAGAGAGCGCTTGCATCCATGTATCCGTAGGAGTACAACATTATCTCTGCAATCATAGCATAGTCCGGAACCATCATCGCTACAG
TGCGGAACAACACCTTCAAGTTGTCGGGTAGCTCTGCTCGGCCAGCATATCCGGGGTTCATCGTGATGAATGGACAGCAAGTAGGGTTTAGTCGGAGTTC
TGTGCCCTCAAAAATGAAATTTGCAAGGTTTTGAGCTTTCGCCAGCTGAATACAAAGAATTTGTTGGGCAATCACCGACAACACCTCCAGCTGAATACGA
TTAAATTCGTCGAAGCACGCCCAAGCACCCGAGCTCGCAAGACCCTTGAAGAATTTTCCCATTGCGAGATAATCAAGACCATCAGAACAGTTTGTGACGA
CACATTGAATGGCAATAGCCTTTGCAAGATCTTTCGTCGTCTCTGTCTTGCCTGTTCCAGCAGGACCCTCCGGTGCACCACCAAGGTTGAGGTGAATCGC
CCCCGTCAATGTCCGGTAGCACCTATCCGTCAATGGGGTGATCACCAAACGCATACTGTTTCCAAGATACTCGAATGCATACAGGGCCAGTGTGTTAATC
ATTCGACACTCAAGAGTATGAGGCTTACCTGTTGTCGCCGAGACCCCACCCTGGATCCAATAGTATCGCAGTTGAGCAAGCCAGTCGAAATCCGTTTTAT
CCGTGATTTTCAGATCGACCAGCTCGGCAATCGTATCGCGGTTGTGTACATCCATCACCACAAGCGCTCCAAGCGTGATGCGAATTAGCTTGGTAGTTCT
CCACGCACCATCTCGACGGTTCGCTTTAG