Description :
From Genome Similarity Track
Location :
contig_107:49609- 50740
Transcript NameFunction/comments
g13109.t1hypothetical protein

Sequence
1131 bases(100 bases per row)
AGCCAGATCGAGGCGAATGCCAGCTGGCACCATGAAGTCCATCCCCAGGATCAGGTCTTGGCCGCCTGTGGGCGGACCAACCCACGCGTCGAAGTAGTAC
ACCAGTGATCCAGCGAGCGTGATCTTGATTCTGGTACGCCCATCCGCCATATAGGGATTCTTACCAACTCCTTCACATTCCAACTCTTGACTGTTGTCTA
TGTAGCACCCAACCTTACGAGCAAAGGCGGCATCCAGAATGGACACCTCGGCGCCGCTGTCAAACAGCAATGTGGCTCTTTCGTTGTTGATCTTCCCCAT
GGCTTTCGCCTGCCGGAATTTCTTGTCTGGCACATGGTACTTCCAATATCCTCGCGACTCTCCGTGCAGGAGATCCAGAGCCATCGTCACTTCTGATCGC
GAATACTCGTCGACTTGGTGGAGGCTGGAGATCGCCATGGTACGTTTGTCATGAAGGTCACATGTATTGTCCGTCGGCCGAATCAGCTTACTCACCTCTG
ACTTCGACTGTTTTTCGACATATGCATAGATGCAGAACTGAGAACGCTCGTCTCGTACCGGATTCAAACCCGGCGAGCGTTCTAGTTTAACATCTTTTCA
GCCGCTTGCGGGAGCATTCCACCGTGCTTGGTGGGGTTGTACCATTGACGGATCAAGTTGTAGAACTCTTCCATCGGGCACTCTCCGGCTCCGTGAATCT
CGCCGCAGGCCTTGCAGACGAAGAGGCAGCGATCGGTCGGGTGGCCCTTCTTGCCACATTTCTCGCACGTCAGACGCTTCCAGCAACCAAGATCGGTGTG
CTTCGACGATCCACAGTGGGAACATGGCTTCCGCGGGGCTTCTCCCTCGAGAGATCCGGCTGGACGATCGAGGCGACGGTCGTTGGAGTCTCGACTAGGA
CGGCGTTGCTCCTGATCCGAATGCGATCTGGTCGGCTGATCGGGCGTTGCCGCGAAGTACACCTTGCGTAGGTCTCCTCACCCTCCGATCCGCTGGTTTC
CAATTCGGAGTCGCTCGAGTTGACTGTTGCGCGGATTGCGCGGACTGCGCGGGGCATTCGCGGATGGGGTGATTCCCGTGGGTGATTTCTGCTTGGGTTT
GATGGACCCATACACCGTCTTTCCTTGTCTC