Description :
From Genome Similarity Track
Location :
contig_142:49606- 54663
Transcript NameFunction/comments
g11611.t1hypothetical protein PHYSODRAFT_478215
g11612.t1hypothetical protein
g11613.t1hypothetical protein

Sequence
5057 bases(100 bases per row)
GCGGCATTTGGGACTCGCCCCAGCGGAGAGACGACGGCGGCATATCGGACAATGCAACTTGACTGTGTCTGGAGTGCTAAGTTGGCAATACGTGATCACT
GCTGCGATTGGCTGAAATTGAGACGATTCGTCAACGGTTGAAGTTGCCTTGACCAGCGCCTGTCTCACCACGCGTTAGACCCAGCAGTAGCTTCAATGTC
CGCATCTGTCGACCTTACTGCAAATGGAGCATGGTTTCGAGGTGTATTTCTCCTCGCAGAAGACTAGCCATGAACTGCTTCATCTTGTCGGAATTGGTGC
GCGGGTACTTGGCGTGGGGCTCGTATCGCGTAGGTGCACGCCAGAACTGTACTCCCACTCACAGCAGATGCCTTACCCACAAAGACGAGGTGGATATCAG
GCGAAGTTCCCCCGGAGGCCTTGGTTTAGCCCTAGCGCCGGGCTGGTTAATGACCCTGCGCGCTCCTACTTGTCGGCTGGACACAATAGCACTAACCACG
AGCACAGACTAGTCTGCAACTTGCACCTAATCAAATCTCGCTAGCCCTCATAAGGAAGGGCCTTCCCAGTAAGTGAGAGGGCCGGAGCAAAACCTCTGTA
TCACTCCCTACTTGAACGAGCCCTCTCTTTCTCTGCAACACACAGCTAATAAATCATACACAACCTACTCTTGTATTTCCGGGTGGATGAACACTTGGTT
TGTCAGTCCACGTGCCCATCGGCAGGCATAATCCGAGGAAACGTTAACATCAGACGTTGGAATCTGAAAAACACACCATGTACATCGCACAATAAGACAT
CGCCAGTGCGTCTCGGCCGCAGCGCCGGTGCATGCGAGGCGCCCGGTTCTGGTTGCAGTTGTCGCAGGCGTCGCGTCGCCGGCCGCGATGGCGAGGTCTT
CCGAACGTGGTGCGAGTGAGACACCCGAGGAAGGCCATTCGGCACTCAAATCCGCCCCCCAAGCCAAGCTACCGCTGTGTTTGCGCCCAGCACCTGCAGT
CGCGTCATGGCAGGACTGGCCGCATCGCAACTGCCTCCGGAGGAGCTGCACGCCGGCGACAAGATCGCGTATTACTCGATGGCCTTCGTGTGCGGTAACC
CTCAAGGGTACCGGGAGGCCATCGTGCTGAAGGTCGATGCTGACCCAGGCGCGACCAAGCCGCTCGATCTGGACAGCAGCGACATCATCTCGTCGACGCA
GATGCTGAAACGCCTAGTGGGCCGCTGGGGGAATGCAATTGGTGAAGGAGGGGCGCTGTGGCGTAAGTTGCGGACTTCACCTTGGTTCGTGGGGAGCACG
AAGCTCCGACGCGAGCCAGCACGTTTAATCGCGCCATGCAGGAGGCAGTTCGGCAGGCATTTGCTGCTGCCCACAGCACTGAACATGCTCCACGTGAGGA
GCTTGCCTGCGCGGTCTCGGAAAGGACGGCTACGAGTAGATCCGTTACGGTTTCGGCACCAGCGAGTGATGTGTCGGGGTCCAGCGCGGCGAGGACGGGT
GAAAGAGCCCCTTCAAGAGGTGCCATGCACAACAAGCCATGGACGTCGTGTGCTGCGCGAGGATTCGCCGCCCATCGGCATGGACGTCTGCCGCGCGATG
GTATCCACTGATATCGGAGACCCAAGGGTTGTGCAAGTGGCCAGCAGTGCTGCAGTTGGTGCGATGCAGCTCCAGCATAGTGAAATGGAGACGCAAAGAG
ATGGGAAGGGCATGCAAGCGAGGCTTCCCGTGGAAGCGATGATCGAGAAACCCAGGACGGTGACATCGTGGCCAACTCGCAATTGGTCGCAGTGAGTGAC
TACCTTCAATCGATCCCGACCCGCCTGAAGCGAGCGAAGATTCGCCACCAGGCCAAGAAGAGACCTGCACGCTGGCATGTCCCCCGATCGCGGAAGCGCC
GCGACCAGAAGAAGTGCGCTGTGACCCGCAGCGGTATGAACATATATCACGCGCACACTGTGAAGGCCCGGTCGACAAAGGAAACTCTACAACGCGCTGG
CGTCAAGGATCGACTTCGCGCTCTTCATGTCCGGCGGCCAAAGTTCGTGGAGACCAGGACCGAGACGCTGGACCTGATGAAGGTGGTGATTTGGCCATCC
TCCGTGCTGCCCATTACTGAGTCAGAAGTGCCCGAGGGACTCGAGTTTGTGGACATTGGTGACGGGGATCCCTGCCAATGCTTTGGGGATTGCTTCATGG
ACTCCTGTAAGAACGCTCTACTATCCATCTACTGCACACCCGAGTGCTGCAGATTAGGAGGAGTCTGTAGCAACTCGCCGCGCAACCACCCGGGTCTGAA
ATTGTACGACACCTGTCGTGTGGGGCTTGGCGTGCACACCACTGACTACATAGAGGTGGGAGATGTTGTCAGCGAGTACGTGGGGCGGTTGTTCGAGTAC
CCCGCTGTGCTGGAAGGCCAGCCCGCACTGGCCATCAAGCAAAACAGCGGCTACACCATGCTGCTCAACACGCAGTCGGTGTCGGGCATGTTCGTCTACA
TAGAGGCGTTGAAGTGCGGATCAATCACAAGATTCATGAGCCACTCCTGCGACCCCAACGTGAAGTTCGTCGAGATGCAGAACGGATCCAAAGTCAAGGT
GCTCGCTCGGATGATCAAGACCGTTTGGCCTGGCACGCAGCTCACCGTCAACTATGGTGACGAGATATGGTTCAAGTGCGGGTGCGACTCATGCTGGGTT
GACCCCGTTGACGAAGAAGAGTAGGAGCAGGTTGGAGACACAAGTCTAGCACTTCGATAATAAGCCCAAGTCGTGCAGAACATGCATAATTATTCAAGTG
AATGTCCACTCTGTCTTTACCAAGCGAGGAAATCGTCCAAGTTATTTTTCTCGGATTCACTTGATCGACATGGATTGTAACCAACATCTGACCGACTCTT
CGCGCTTGGAATCGTCGAAGCTCAGCGCCTGGGGACATTCACAGCAAACGATCACATGTAGTAAGTGGCCAGTAGGGAGGGCAACACCATTGTGGGCTCG
GGTCGACTCTAGTTGTGCTTACCTGTACCCTGGACGTGTTAGAAAGTCAGCGCTGACCCACCGACAAGGGTCTCCCTCCTTCAAGGGCGTTCACGGTCTG
TCGCTTACGTTTAGACTTCTTGCGACTCACGAGCACCTCGTTACCGGTGGCGTCGATGTAGCCCGAGCTTCGCGTCGCGTAAAGCACGTGGACGCAAGAG
CCAAACGCGAACCAGTAGCTACAGCGCACCACTTGCGGTCGATGTCTACGACCCACCCACTCCAAGGCTGCCCTTCCACTTCCATGCGGGCATAGTTAGA
CCCCATTTGAGCCGAAACTGCGATAGCTTCTTCCGACCGTTTGTTGGGAACAACGCTGACGCGATCAACGAGGCGTGACTGAACCTGAAGGGTGCGCGAG
GCTCCAGCGCCTGGAATTTCGAGTTGGTTGTCGTTCCACTTCCCCAAGTAGCCTTTGCGCTCCATCTCTAAGGCTCTGCGCGTGAGGGTTGCTGGTGGAA
CGACATCAAAGCGGAATGGGCGGCCGTTAGACAGAATTGCATACCAGCAATCTGTAGCGCATCTGATGCGGAGCGACGTCGGAGCAGGCCGTGCAGGCCA
TGGGGTTGCTCTTCGTGATCCCTGCCGATCGTCTGGCACCCAGCTGCGACATTTGGGCTCCACGAGCGCTGGTTGGCTGCTTGGATCAGCCGCCAGGCCC
GTTTGTGCGTTGGTTCAGAGAATGAGCAGATGTGAAAGACCCGACATCCGTTTTGTGTTGCTACCGTAACGTGTGTCATTTCCCTACTTCTGAGGTGCTG
CCCCACAGTTTTGGTTCCACGTAAAGGAAATGCGGTGCGAGTCACGCGTTCTCCATAATCCTGGCGATCAAACGAGATTAGACACTACGAACACTCAGCT
TCACCGGAGCTGAATTTTGTGCGCCAGGGAGGGAAATCTGCTCTGTTTGTTGCCCAATGCGGGTGTTATCACTATACTATGCTTTCATTTGTCTTAATTC
ATGGGCTCGTTCGTTGGTAAACTCCTGAGTTCTCGGCGACTGCTCGTCAATGGACACAGCTTTGATATATATTCGTATCATCAACGTAGAGACACACCAC
GCACTCGTTATCTTCGTTGCCTCCCACGCAGACACACAGGTCAGCATCGACAGCTCTGAATTCCATGCCCTACGGTGCTTGCAAATAATCTCATTCCACA
CACGAGACACTTGCTTCAGTCCTTACAGACTTTGCAGTAGCAAACTCAACTCCTCATCTCCAACTTCAGCCAAGGTCAGCAGACCCCGAAGACCTTTTGG
TAGCTCTATGTAGATACCACCTTCAAGCTGGCCGTTCAGTAACGCGGTGTCAACGATACGGCTCGATCCCGTTCCGTCCGCGCAGCACTTGCTAGTATAG
CACGAATCGAGTTTAGGTAGGCCACTGGCAAGTACGTCTCCTCGAAATCGATGCCATACCGTGGTGAGTATCCTTTATACACCAGGCGAGCCTCGTGGCA
AATTCCTTGATCCTTCTCGTTGCACATTAACGCGAATACTCAGCGGCATCCAATCGGGTGCTGTTGACCAGGCCTTGGTACCAGCTTTTAGATCTTGTTG
ACAGTGAGCAACTCCAGCTCACTCGCAATAGCACTGTTCCCTGAATCTTGGTCTGCACTGTTTGTACGATTCAGATACCCCCTCGGTTGCAGTCATTACT
TGACCACCTTCAACGGTGAGCTGTCTTTCGTTCGATTGAACGCACCTTGGAACATCTTCTGGTGTTTCGTCCCGATTAATTAATTGCGTCCTTCGTAGGC
CTCCTTCTTGCGTTACTGAATTTCCTTGTACCCAGTCTTCGTGCAATAGAAGCACTCGACTTCAACATCATAGAGGGCATTGATCGCGGACGCCAACGTA
GTGTTCAAGTACGGTACCCGTCCATCAGACCACGGAGTTTTAACTTAAGCTGTCGGATACTCATCAAGAGGCACACCAATCGTTTCAATCTGCAATACAA
TCTCCTTGAACTGGTTCATGTGCATCGCGAACCGCGTACTGGACTCCACGTTAAAGG