Description :
From Genome Similarity Track
Location :
contig_61:49602- 52015
Transcript NameFunction/comments
g9186.t1hypothetical protein PHYSODRAFT_454443

Sequence
2413 bases(100 bases per row)
AGTTGAAGTGACCACCACTCTGGCATTCCGCGTTAGACAGAAGACCATTTTAGGCAAGAAGCGCAGAGTATGAGCCGCCTGGTGCCATACCGGACGAAGG
TGTCGGAGGACGTGGCAGCGCGCATCGAGCTGACGCTGAACACAACCATGTACCTGGTGCAGACAACGGGCCCCACGTCCTACGTGGTGAGACTGCTACA
CGCCTCTTTCCTGGGGCTAAATGAGTGAGTCTTAACGATTTGGTCGCTGTAGATCCAGGAACAGAACTGCGAGAAGAAGCACAAAGTCCTGATCGGATCC
TTGCAGACCTGCAGCTGTGGCACGGCCGACATTTGCATCCACATCCTGTTTGTGATGCTCAAAGTGCTTCGAGTGCCCGCGACGACGCCCGTTGTGTGGC
AGAAGTCGCTCATTGATTCAGAGGTGTGTGGTGTGTGTGTGTGTGTGTGGGGGGGGGGTCCTTTGTTCTATGGAGGTTGAAGTTTCTGATTGCGGTGCTG
TGGCTGCAGATTGAGATGCTGCTCCGAGGAGGATACAAGCAGATGACAAGACCGGCCCCAAAGCCGTACAGAAAAAAAGAAGGAAGAAGCGGCGACTGCG
CAACCTGAAGATGCAGACGTGAATAGGCACGATCTGGTGGAGGGGGAAGTTTGCGCTATCTGCCAGGAAGACATGGAGGACAGCCAGCCGCTCACTTTTT
GCCGCAAAGGGTGAGTGGTCCTTGCATTAATTGGTGGCTGTATTCTTTACTTACGTCTTTCGCTGCAGTTGTGGCAACAATTTTCACATCGAGTGCATGA
AAGTCTTTGGCGAAAGTCGGAGGCAGTCGAAAGAAAACATCATTTGTCCGTTGTGTCGTCAGGACTGGGGCGAAACGGGTCTGTCTACGTTGCGAAAAGA
GATGGATGCAGCGAATAGAGCTCCCAATGTTCATAAAGGTGCGTCGTGCAGGAAATGCAAAAAAAACCGCTTCGGTGTGAGCGTTATCGCTGCGTTCAAT
GCAAGAATGTGGATTTGTGCGCTCGATGCTTCAAGTCGAATGCTCACGAAAAGCACGCGTTCGTGGTGAAGTACAACGTTTTAGACTCGTGGGTTCCAGC
TTTGCGTGACAACCAGCCCCGAACAGCAATCAGCTCGGATCTAATACGAGACCTGGAAAACCGAGAACTATCAACAAATGATTATGACGTACTGCTGCAG
CTGGACCAAGGAGGCAAGCACCCTATTCAAGACTACCTCGTGAAAGTGCTGCCAGGCACCAAAGTCGATGCTGAGAATGCCAAAACGTTTGGTGATCCTG
GTGCGACGTGCTCGTTATGCGCTCAAAGTCTGCGAATAAGAGCTTCTCTGCATTCGGTGCTGTGTGGGGTGCGTAACTTGAGACTGCTTCATGTAGTTCT
CTCCATATTTTCTAATACGTTCGCTTGTGTGCGTAGCACGTTTTCCACGAGAGCTGTCTTGCTCGATCCATTTTGTCCCAAGTGTATGAATGCCCTTTTC
CTGGGTGTGACCAAGCGCTGTTGCCGGGGTTGCTGTATCTTCAACAGAAGCACAAAACTAGCAAAGCTGAGGTTTCAACTGAACTGAAGCAGGAACTATC
AATTGCGATGTCAGTGCTAGATTCTTCGTTCACCGTACTGGGACTTCAGCAACAGCGCTTGGGTGGCCAAGGAATTGGAAAGGTGTCAAAGGTAAAGAGA
GGTGGGATACACACTCGTCGAGAGGATAGTCTTCCTTCAATATCGGGTATTATCTCGGTGGGAATTGTACCGCATGAACGCCACAGCGCACATACGCCCG
CTTCAAGAGAGCGTATGTCCACGCCGACGCCCAATCAGTTAGAGCACGAAAGCATTGTATCGATAAATTCCAGTCGGCCAAGTTCTACCCGCGCAAAGGG
AAAGTTGGGCAAAGTAACACGAGCACGATACGCTCTTCCACCCCTCGACAACCACCAACACTTCCCCGTTTCCTGTTCATGACAGCGTGACAGAAACCCG
TCTCAATCACGCTGAGAAGATTCGCGCCGAGCTGAAGGCTGTCGAGAGAGATCGCCTTCAGAAGCGTCAGCAAAGAGAGGAACGCCAACAGCGCCACAAA
GGCACAACTGCAATCAGCTTTTACAGGTGATTTCTTGGATCGGAACAAAACTGAAGTGCCCAGAGTTGCCAACAATATATCTGAACAGCGATCGCAGCAA
CGCCGCGAGTTGAAAAGGAAGCCAAAAGAGCGGCAACAACGCGGTCGACAACAGAACGAACTCCTGATTACTCTTCCAGATTTATTTGTTGGCAGCAGGA
GATAATGAGTGGTGTTGCGGGTCGTATGGATCTATCTAAACTAAATAATGGAATTGCGGCGAACGTAAGCTGACGGGTGAGGTGGATGAAGGCTGCCTGA
GCTGTTCGAAAAG