Description :
From Genome Similarity Track
Location :
contig_141:49600- 52780
Transcript NameFunction/comments
g13763.t1hypothetical protein
g13764.t1OWZ18694.1 hypothetical protein PHMEG_0007173 [Phytophthora megakarya

Sequence
3180 bases(100 bases per row)
AGCTTCCGCTTCCACTCGCTCTCCAGCTGCTGCATGGCCGTCTCCGCATTCCCCACATTCCTCGCTGTCTCCTCTTGTTTCTGTCCGCTTTTCACCTCGA
AAACCAACGGCAGCAGCGTCTCGATCTCCTTCATCAAGTCTCCCAGGTCCGTGCGCTTCACCGCCAGATCGTGTCGCAGCTGACGCACCCTGTGAACGTC
GATATCCGCGCGCGGGAAGCCCTCACTGTCCACCAGCGGTCCGCGCAGCCCCGGGTTGTTCCCAGACGTCAACTCGGCAGCCAGCGCCTCCATCTCCGCC
TCCAACGTGTGCTTGGCCGCCTCAGCGCGCGCGTATCGATCCAAAACGTCCATTTTGGGAAATGAGCGCTTTTCATTCGCTTAAAGTTAGTTTCCACCAA
TCACATGACCTTCTTCGCCTGCTACCTGCTGACGCCCGTGCAGGCGCCGCAGCGACTCCGCTGCACGTACGTGGGCTTCACGGTCGCTCCTGCAAGGCGC
ATCCGGCAGCACAACGGCGAGCTGGCGGCGGGGGCTAAGCGTACACGCAAGAACCGACCATGGTAAGTGAATACGTAATTAATATTATATTCATATTAAA
AATACTAGTCACAATGTATTAAATCCCATGTGAAATGCTATAGGGAAATGGTGGCCGTAGTGCACGGATTCCCCAGCAAGTTCCGCGCGCTGCAGTTCGA
GTGGGTCTGGCAGCACCCATCGGTGAGTAAACTCACTAGGAACCATCTTGAGTTCCTGCGAGGCTCGAGAGGACTGGGGGCTCCACGGTCGGTCAAAAGG
AAGGTGGTGGAGATGCTGGAGATGGTCAACCTGGACCCATGGAAGACGCTGAACCTCACCGTGAGCTTCACGACGGACGAGGTGCACGACATTGCGAGGA
CGCTGGGGGGCAGATACAGCGCTGCAAAGTGCGACACGAGAGCGTTGATCACTTTTGCTGACGTCACTTCAACTTGCAATTGTTTCGTTTGTGAGTCCAC
AGTAGAGGACAGTTTGGATGACGCGGTGGGGTGTTATCATGACGGGTGCGACATGTGCTGCCATCCCGAGTGTTTGGTGGACCATTTTCGGTCCATGAGA
GACTCGGAGGAGGACGAAGAGACGAGTGGAGAGTGTCCGCAATGTCAGCAGGTTCTTAAGTGCCGTTTGCTGACGAAATATCATGGGGAGAAGAAGAATC
GGAAGAGACGACGTGGTGGACGCAGAAAAGGCGAGAAAAGAGTGCGCGTGGCAACTGCACAAGGGACGAATGATGAAGAAACACACCCTCTGCGTGTTGT
GGAGCAAGGCCCAACTCCAGATGATAGTAGGCAAAAAAGATGCGACGGAGAGGGAGTGGATGCGATTATCATCGGGTCGCCGCCTTCTTCAGGAAGTTTT
GCGGCTGAGTACAATTCGGATGGCTGGTTTGAAGACGATGGGATTTACGCTAACGATGGTGGTGCAGGCTGCAAGGACGCGGAGTCGGAGCAAGACTGGA
GGTCGCAAGCTCCTCTCCACATCCTCGATGTTCATGTGCCCAAACCTGCCAACGAAGATGTGGAAATGATCGATCTCACGGAAGAATAATCCACTTTTTG
AATGCAATTGGATGAATTGACTGAAGGGGATGGCGTCTATCCGTCCTGAACTTTCGGGATGCACATTGCAACAGGCGAGCAAGGTGCCGTGTAGCAGTCC
GAGTCTACGAGCTCGCAGTCTTCGCGCTCACTACAGCGATCTGGTGAGCATACGTCGGCACAGTACGCAACAACAGCCTCGTCGGGTTCGATCTGTTCAA
GGCACTCAGTGTAGGCGGGGCAGGTCATCGTTTCACACGTAAGCTCTGTATCCGCATCACATTCGCCATCGTGCACAACTGTGAGCGCGTGTTGCGGGTG
CTGGCACCTCGCGTTGGCAAAGAGACACAGGTTGTCGTGAGTCTGGCCATCGGACCCGCACACGGGCGCGTAGGTGTATGGACAAGGTCCGGGGACGCAT
GATTCTCCACCATTGGCGTTACTGGGTGTGCTTGCGCTACGAGCAGCTAGCATGTGTAGCGGACACTTGCCAGCTCCGAAGGCCTTGATGCTTGGGTTGC
GGCACTCAGCGTACTCAAGCAGACACGAGTTGGCGTACGTGATACCGTCTGAGCCGCAAACAGGATCATATATGCGCTCGCACATTGGGTTGCATTTCTC
CGGTGCTGCGGTAACTCCTTCGTCGGTGGCAGTCTCTCCGTCGACTTCCAAGACAGCCAAAGCGTCGTTTGCATCTTGGCTCTTGGCACATTCGCCGTGT
GAGGCCTTTTCCAGCTCTGGGTGCTCGCACTTCGACGACAGAAGGTGGCAATCGTTGATGTACGTGACTCCATCCGTTCCACACACTTGGTCAGGGGTCA
GCTTGCACGTGAGAGAGCAAAACACCGTCTTCAGGTCTACTTGGGTGCTGGAATCCAGCTGCTCATTAGGGTCGAGAACTTCGACCTGCATGTCGGAGGG
TGGCGCGCTTGAGACCTCTTCTTGGTCTTGGCTGTCGTCAGTCAAAGGAGGACAAACTCCTAGAGCTCGGATAAAGAGCGTGTCTGGGTCACTTCCCCCG
GAACAGAACGTTGAGGCAAAGACGCAGTCATTGGCGTACGTGATCCCGTCGGACCCGCACACTGGGTCATACGACACCACCTCGCAGTCGAACGTTTGGG
TGCAGTCGATCAAAGCTGCTGCTTGCCGTCCCACGTCAATTCCAAGCGGTGCAGTAGCAGACGTCCGATCGCCAATGCTGTCGTCTTCACTGTGGCTCTG
CGCAGTGACAAAACTGCAAACAGCCCGAGAAGAGATATGAGTCTCATGAGCCCCTCAGCTCTTGTATGTCGAGGAGCGTTTGGTCCAGATTCGACAATGG
TTCTGATGCTCTATTCTCGATGCTGCGTGGAGCAACCCAAGTCTATCTGCACCAAAATACGCGTACCCGTGAAACTGCATCTGTCACGCGTTCAATATCC
GAGCTCCCTGTGTTCAACGAGTTATTCGTGAATTTGAAACATGGGACGGGAGCAAAGCGTCCTCTTCGAAAATAGTTGGCGCTCATGTTGGAGCAAATCA
AGTTGGAACAATTCACAACGAACTGGTACTATCGACGGAGGAGCCTTTTACCGATTGCCGGGCTTCCTTGGACGTCTGAC