Description :
From Genome Similarity Track
Location :
Scaffold_574:4960- 10088
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_574-snap-gene-0.5Poly [ADP-ribose] polymerase 2
Pytul_var.sporangiiferummaker-pug3_contig_574-snap-gene-0.7CAAX prenyl protease 1
Pytul_var.sporangiiferumsnap_masked-pug3_contig_574-abinit-gene-0.12Type I inositol-3,4-bisphosphate 4-phosphatase

Sequence
5128 bases(100 bases per row)
GCGCGGCATGAGCAGCATGGAGATCGCGAATCTGTGCCACCAGCGCAACTACCTGGACGAATGCTATGAGCTGTTGGACTGCACGCTGCACCCTCTGTCG
GAGCACTCGGACGAGTACGCACTGGTGAAGACGTACATGAAGAACTCGAGCTGCTGCGGCTGGAAGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNACAAACCCAGCGAAGATCGACGTTTTGAGCCCTACCGCGCATTCAGCAACCGAAAGGTACGTTTCCCCCTTGCATTAGTGT
GGAGCACAAGTGCTTGCAACAGGCTCATGACTGGGTCATGTGGTGTTTTATTTTTTCCAGATTTTGTGGCATGGCAGTCGATTGAGCAACTGGCTGGGGA
TTTTGTCGGACGGACTGCGGATCGCGCCACCCGAAGTCGCGTCGAACGGTCGCATCTTCGGTAAGGGCGTCTATTTCACGGACAAGGCGTCCAAGGCGCA
GGCGTACTGCCACGCGAGCGCGCGCCACGGCGGCCAGAACAAGTGCATCTTCGTGCTGAGCGAGGTGGCACTGGGCGACGTCAAGGAGATGACGGCATCA
GACGAGCACGCCAAGCAGTGGGTCCACNNNNNNNNNNCCAAGTCGTCGTACTTCCACAGCTGCAAGGGCGTGGGTACGTGCCGCCCCGACGAAAGCGGCG
ACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGACGGCGCCATTTGGCCACTGGGCAAGCCCACGCAGGCCACCGAGGCCACGGGCCTGAG
CCACTCGGAGTATATCATCTACAACCCCGCGCAGGCGCGGATGCGCTACGTCGTGCTTGCCAAGAGCGCGTACTAAACGCCTTTCTTAGACGCCACTCTC
CTGCTCTCCATTGCGTCTTGGCTGTATGTTTTGAATGTGTATTATGCGTATGTATGCGTTTGCGGGGGTTTCTGTGTGGTTAAAACGCATAAAGCTGGTG
CAATTGTGAATATGTTTATTGGCATATTGTCGCTTGGTTCTCATTGTATCCATATAGACCATTCTGCAGCTTTACTGGGTCTTCTTGGCGCGGTCATTGG
CACGGACCGAAATCGCGTTCAAGCGCTCGACGAGTGGCGGGTGGCTGTAATGGTACGCGCTGTAGAGCGCATCCGGGTTCATGTTGGACAGGTTCTCGAT
CGCGAGCTTGGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGCGGTCGTGGCCCAGGTCCACGGCGAACGCGTCGGCCTGGAACTCGTTCT
TGCGCGTGTTGAGCGTGATCAGGAACGACAGCACGTGCTCCACGGGCGCCCACACCGTCTGCGAGAAGAGCAGGAAGCCGATGATCACGGGCTTGGTGTC
GCTCGCGAACCCGAAGCTCGCAAACAGCTCGCTGTCGTGCATGCACAGCCCGAAGACGTAGAAGAGCACGAACGTGTACACCTGCTGGATCACGAAGCCC
TGCGCCGTATGCCAGAGCTTCCAGTGGCCCAATTCGTGGCCGAGAATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGTCGAAGAGCACGATGCGCTTGCTCTTGAAGAAGCCGAAAAAGTACGCGTTGCTGTGGTTTGACCGCTTCGAGCCGTCGCATACGAACAGCTTCGTGA
GAGGAAAGTGCAGCGACGACGCCAGTGCTTCAATGCGCGAGCGCAATTCCCCTTCCTCCAGCGGCGTAAACTTGTTGAACAGCGGCATGATGAGCACCGG
ATACAGCGTGACCATGATGAGCGAGAACGCGAACAGGAACGCCCACACGTACAGGTAGAACAGCTCGCCGCCCCATCGGATCACGTAGATCAGCGCTGCT
GTCACTGGGTACCCGATCACCATGAACAGCACGAAGCCCTTCAGCTTGTCCATGAAGAACAGCCCGAGCGTCTGCTTATTGAACCCATGGCGCGCTTCGA
CCACGAACGTCGAGTACAGCGCAAAGGGCAACCCGAACAACGTGTCACGGATCGACGTGAGCGTGAGCAGCATGAGCGCCAGGTAGATCTCGTTATGCGC
ATCCAACCCGACCGCCTCGAGCGCACGGCCACTTACAGTCCACATGAACGGTAGGTACCCCAAAAAGAGGAACGCTGTCGCTTCCAATTGCGAGTACGCA
CCAGACACGAACGCAAACGTGCTCTTATCGAGACCGTACGCGCGGCTCTTGTCGAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT
CCAGCAGCGAGATCGGCTTTGCCGGCTCCTCAGACTCCTTCTTTCCGTCATTGTCGTCTTGCTTGTCCGCATCGCCCTCGTGCTTCTTTTTCTTGGGTGT
GAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTGGCGGAAGTCCAGATACGTCTCGAACGCGTACACGA
CCGTGATGAACACGATCGACGCCTGGAAGTACGGCACCGATCCCGGCTGCCACCCCGGCTGCGTGAAGTACGGCGCGCTCCACCACGAGTGTTCTTCGGC
CATCGGAGCTGCTGGAAATGGTGACAAGATACAATAGGCGTGCGGGGAACGCGGCTCTCACTAAGTACNNNNNNNNNNGATCGTATATACCGGTATCGTA
TGTCGGTAGTGGAAGCCATAACCTGCGGTTTGCATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACGAATGTTGT
AACCTGCAACGTTGAGCTCAGCCAAAAATGTTTTAAATGTGTCACCATTTTAGTGACTTAAGATTTAACGACACTATGCTTAGCATGCACCTCCTTGCAG
TAGATTTCCCTACTCAATAGTGGTTTTTGCATTTACTGACACCCGCATTCGATCGTCCCGCACCAGTACGGGNNNNNNNNNNGGAAAAGAAGGAACCTTT
TCTCTGCGCCAACCCAGAAAGCACCAAAAGCGCGGGGCATGCAACTCGAAGCGTAAGAATGGTCGCCTCCTCCTCCGCGCCTCGACGGTCCCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCGCCCACTGCGTATCTGCGCGCCTTCGTGCTGCTGCTGCTGGCATCGGCGGCATTCATCGGCCACTTGC
CTGCAAGCGCCGCGGTGACAGGGACGTTCGCTGCGACCATCCGTAGGGAACCCATCATCACTATCACAAGCAGTGGCGATGGCTACCAAGAAGATGCGCC
ACCAGCAGCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGAAGACGACGTGGACCCGGCGGATATCAACGACGGGCTCGTGTTCCTGCCGCGGCCGG
CGCTCCCAGTTGAGATGTTTTGCGTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNGTACCTGGCGCTCGCGATCGTCGCTGCATGCAAGGCGCTGTCGCTC
CCCACGCGGTTCTCGGCGTACGAGGTCAAGCGGCGACACACGTTCCAGCGACTCATGACGATCTTTGCGCTCACGCGCACGATCTCGTTTCTCACGGGCG
GCATCGCGCGTGACTTGCTGAACCGCGCGGCGCTCTGCTTCTTCTTCTCGCTCGTGCTCTTCCAGGTGCTGTTCTGGATCGACATTGCGAACCCAAAGAT
CTCGAGTCGCTCGAAACGTATCTGGTATGCGTTTGTGATCTCAAACGGTGTGTTTTACGCGCTTGTGCTTGGACTCTCTGTGCTCCATGTGTGCACCATG
TATAGCAATGATCAGTGGGAAGAAAACAGCGATGAGCAACCGCAAACGGAATTATTCACAGGCGTGCTCCCTGTGTTCCTCATTGCGAGTGGAAGCCTCG
CGAGCTCGTTGGGATTGGTGTATTCGACGTGCAAGATGCGGCGGCGAGTTGGACGCGTTCTGAAGCAGTCTGGAGACGGTCAACGACGGCGACTGGACGA
GCGTGTGGAAGCGAAGCTGCACCGTGCACTCCGATTTACAAACTTTGTGATGACGATCTGCTCAGTCACGTTCCTGCTGCGCACAATACTGTACATTCAA
CGCCCGTTTTCACACAGAGGCTGCGGCGACATCCGCGATCCCAACATTTGCATCATCGTTGGATACACTATCCCAGAAGTGTTGCCCTGCGTGCTGTTTC
TCATTCTCATGTGGGAAGTTGAGCCAGACATGCAGTTCCCGTCGCGAAGGAGACCAAGCTTTAATAGCGGATTGACAAGCGAGGCAACGCCATTGCTGTA
CGATGGACAGTCGCCATTAGTGATCACGACGAAGCTGCAGACTAATGGAGCTCCTGGTGCCAATTCGATGGCACGGTCGTCCAATTCGCCCGCTGCTGGT
GCTATTGGTGCAGCTCGTGGTGGGTATCGAGTATCGAATCGACGCTCCAGTCCACTTTCATCTGGGCTCGGAGGAAATGTGCTCGAGCAAGCTCGGCGAC
GACTCGAGCTGGCTTCAAAAAAGGAACAAGATGCAAAGGCTGGGCTGCCAGCGCATCATGCCCCTGCCTTGCATGACGCCCGCCTAGTGAGCTCATCTGG
CAGGATACGAGACAGTAATCCTGTAGCACAAAAGAAGCGATCCACATCTGCTTATGCTGCTATGACTTCGACGCAGTCGTCGGAGAGTATGAAAGCTGAA
GAAACGACAGCATACGCGTGGCTATCATTCCAGTGTTTTAACCTGAAACTACCATCCTCGGCTGGGTCGACATCGTCATTTCTTGTTCTGCACATTCTTG
ATGCTGACACTGGTGGAGTAGTCGTAGAGATTGGACGCTCAGAGGTATCGACATCCGAAGACCCGTGCTTTCATCTCATGCTTCCAGTGGAAATGCGTGA
GCAAGATCTGCTACGGATATCGGTCTATTCTATCCGCAACGTGAACTCAATCGATGATCTGAAAAGCCAGTGGCTGGTAGGAGATGCGCTCATCCCGCTC
GTGTCCTTCATGACAGCGTCAAAGTTTGCGTTTGGAAGAGCAACACTGCACGCGTTGTTCTCGCCACTTTCTCGATCCCGCTCATCAGGGGAGATTGTCG
TTCGATGCGAAGCTGAAGTAAAGTGTGC