Description :
From Genome Similarity Track
Location :
Scaffold_2815:496- 2101
Sequence
1605 bases(100 bases per row)
ACCCAGCAGCTGGTCATTGACCTGACCTGCACCGCTCCGCGGATAACGTGCCGCACCACGTACGCCCTCAGGGCAAACAGCAACCTCGTTGCTAACAATT
TCGGACATACCAATGTCCAGCACTACGGCCGCCTCGGCCTCGTGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCATGACTCACCAAAG
CTCCACTAGGAGCAGGGTGCGACGCACCCAGCGTTTTCGACTTCCAGTCGATCCATGGCTCATGACGTTCCAGCCATGCCATGCCAAGGATGAGGTCATA
CCTCGCATCCAGGTCTAAGACCAAACAGCGTTCCACGCTATCGAAGCTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTC
CCCGTCGCGAGACGGACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCCTCAGCATACAGCTGACTCCCTTCCAGGGTGGAGCGACGGGCGTAGTTGC
CCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCCCGGCTTGCACACACTCTTCTCGTC
AGAGAGCTCAGCTCTCTTCGGGGCTGAGCCCCGTTGTCCTCTACCTCTTCGAGGCACAACAGAACTCAGTTCTTCCCCAGTAGGCCGCCCCGCGCATACT
GGGAGTTGCCGTTTCCCGGCGATGACCCGGAGGGTTGGCTCGCCGGAGCCTCGCGCTTCTTGCGCAGAGGGCAATAGGCCCTCAAGTGCTTAGTGCTATT
GCACACAAAGCATCGGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGGCTCTGGACCGCTC
GAAGAGCTTGCGCTACCAGCGCTCCAACCAGGTCGCGCCGACCTGAAGTTGTGCTCGGCATTCAATGGCACATCTCCCCCGCCTCTTCAAAAGAGTTAGG
GGTGTACACGGAAACACTTCTGTTCGAGCTGCGCTCCACACGCAAGTCCCTCTCATGTAACACGCGTCCACGCTGAAACAGTTTCGCGGAGAGAGTTCCA
CCGCCCATTTCGCGCGAATAGAGATTCTCAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTTTGACCGGACACGGTA
CGCCTGATTAGGCGGCGCGAACACGCGCGAAAGCTGTTGTTTCAGCTGATCCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCCAT
TCGCGAGCGCGACCTCCAAGCCTGGAGATAGCCAGCGCCACGCGCTGATGCTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTCC
AGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGC
CGTTGCGGCGCTCATCTTCTCTTGGACATGCTGCAAGAGCGCGTTCTCGTAGCGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGAT
GCAAG