Description :
From Genome Similarity Track
Location :
Scaffold_1462:4958- 7387
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_1462-abinit-gene-0.8Endoplasmic reticulum-Golgi intermediate compartment protein 3

Sequence
2429 bases(100 bases per row)
GCAACACAGCAGGTGACCTCTCGGGTGGACTCGCCGACTGGAAGCTCTCAGAGCCAACCATTTGCTCCAGGCCAAAGCCCCGACGGCCCACCAGGTCGTC
GCCGTCACCGCCGAGCTTGTCGTCGTCGTTGAGGCGGTGGCGTCGGTTCTGGCGACGCATCCGTGACAGGAAAGTCGGCAGATCCGCTGCATGCTGTCGG
AGATTTCTCTTTTGCGCCGATAGACTTCGCAGCACTGGGATGGGGCTGCTACTGTGAGTTGGCGAGAGAATCGACTTGGTGGACGCCATGGGGTACGAAC
AGTTCTCCACCAAAGCTGCGGTCTTGACGCCCCAGAAGACCTGCGCGACGCACTTTATCGACGATCGGATCTTGAACGAGAACCGCATCGACGCTGCGTT
CTCAGCATGTGCTGTTGCAGTCTGGAGGTGACTTTGGCTGTTATTGGTGCGAGTGAAAGTGCGAATCACAGTGAGCGACGACGCTGGTATCTCGAAGGGG
AGACGCACGCTCGTCATCTTCGCAGACGATACTTCGAGCTTCGTGCGCAGGAGCTGTTGGAAGTGCCACATGGACGCGTGCTCGAGCACCGACAAGCTAC
AAGGCCACATATGGAAATGTTAAGCGGCAGTGAAAGTCCTGTGGCTTGGCAAGCTACTCTGAGGCTAGTGAGTGTGTGCACCTGGGTCCGAGGTCTTTAA
GATGAAGGACCTGTGGGATACAACATTGGTTATGAGCTGTGTGTGAGAATATAGCCAATGATCGCAGCCACAATAGCCGCGAGTGCACGTACTGCGTCCG
AGTTGACTGCGAAGCGCACGTCCACGAGTGTGAGAAAGTGCTGCGTGAGCCGCATCGTCCAGCCGACGAAGCCGCAGATGAGCACGATCACGACCAAGTT
CCAGAGCTCTGGTGACAGTGGGGGTGGCGCTGCGTATTGCTGCTGTGTTGCTGCAGATGGCTCCATCTGCTTTCTGCAGCTCAAACACTGGCAACTCGCT
TGCACACAAGGATTTTATAGCAAGCAGCAAAGAATCAAACTGTCGGCTGAGAGAAAACTGAAAACGCCTCTTGATCTCATTTAGAGAGACCGTTCGCGTC
TCGTTCCTCTTCTCCAGACTCCTTCACAAACGTCTGACAAAGTCACAGACTCTACATGGAAAGCGGCGTGTTGGACGCCTTGTTGAGCACCGCGAAGGCG
AGCGAGTCCATGATGCCCATGATCTGGTCACACGATAAGAGCAAGCAAACAAAGTCACATGCAAAAGAAGATTGGTCAGTTGCTGGATCATATCACAACA
GTGGTCAGAGGAGCATAACGGAGCTGCACCGTGAACACGCCGCCGACGATGGCGCAAACGCTGGTGAGGAACTGCAGCAGGCCCTTGCGGTACTCCTCGA
TACGGAACATGATCGGCGAGAACGTGTACGAGAGCGACACCACTGTACGTACAATGGAAGCGAGAAGCATGAGCTGCGTTGATAGTAGTGATAAAAAAAA
TGATATAAATACCAAACCGACGTACTCGGGAGACCCTTCTCGCTGGTCGGCGTGAGCTGGCGGAAGTGCTCAGTCGCCGAGAACTGGTTCGTCACGATGT
TCGCGCCCGAGAGGAAGTCGTACTCGGTCGGCACAACCTATTGGCACATCCGATACAAAACATTTTTAGTCAGCTAACAGTGTTGGAAGCAAAAGATAGA
TAGCTTTAGTAGGGATTGCTGACCTTGAGGAAGTACTGGAACGAGCCGCGTGCGTCGTCGTGCAGCAGCTTCTGTCGTCTGTCGAGCGGGTTTTTCATGT
CCTATGTCACGAGAAGTTCGCATCCATACCAGTGTCATCAAAACCAGTTAGAGAACCATATAAACAAGCAAGGCACATGATCAAAATGCCACCAGAACGC
ACCGGGAACGGCTCGCCGAACGAGAGCGACATGATCGTGTGCGACGTGTCAAAGACCTTGAACGTCGCGTCCACGAGGTCCTTCGCGGACAGATACCCGT
TGCGAAAGTACTTGGACGGCGCAAAGTAGATCTTGCCAGCCACCTTTGAAGAAAAAATAGAGAATTCATGCCACACACGTGATTATTAGAGGGGTGCTAC
CACAACGACAACAATGTCGCAAATCCGCACCTTGGACACCAAGAGCGAGCCTTTGATGCGGCATCCTTCCTTCACGTCGCCCCGCAGGATCTTCTCAACC
TCGGCTTCTTGGCACTGCACACGACACATGCCACGTTCACGGTTAACACCAAAGCACATAACTGATTCACGACACCAAAGAGGAGACAAGACGCACCTGG
TAGATCGTGTGCAGACTCGGCAACTGCCAGTTCTTCTGCGCGTGCGCGGCTTTCACTGAGTCGCACGTGTTGCAGCACTGAGCATTCAAATGCAGAGAGT
GTGAGTATGCGGCAGGCTTGCGACGAACT