Description :
From Genome Similarity Track
Location :
contig_42:49577- 69896
Transcript NameFunction/comments
g9459.t1hypothetical protein
g9460.t1RAW27810.1 hypothetical protein PC110_g15793 [Phytophthora cactorum
g9461.t1XP_008904795.1 CMGC/MAPK protein kinase [Phytophthora parasitica INRA-310
g9462.t1ETI47774.1 hypothetical protein F443_08059 [Phytophthora parasitica P1569
g9463.t1hypothetical protein
g9464.t1hypothetical protein
g9465.t1RAW27818.1 hypothetical protein PC110_g15789 [Phytophthora cactorum
g9466.t1RAW28329.1 hypothetical protein PC110_g15289 [Phytophthora cactorum

Sequence
20319 bases(100 bases per row)
CTGCACCGTAGCCACTTTGCAAGCCACCGACAGGTTCGAGAACCGCACTTCCAGTTGCGGTTGCGTCCGTCCAAACGCTGTCTCGAACTTGTTGGCGACG
GACTCGTAGAATACTTGGGCTTCCGTGGTGGTTACCGCCTTTGCCGGGACGAAGTTGGGCTGACCAAACTCGGCTCAACACTGGAGTTTTCCATCGCTTC
AAACTCTCGCTTGGAAGTGAATTGGAAAGTGGTGTGCTGCTTGTTTGCCGTCACGGCTTGTGAGTCGTAAGGTGCTGGAGATCATGATTATGCAGAAACC
TGCGAAATCTGGTGTTGATGGTGGCAGCAGCGGCGGCGAGTGCCGTTTGATGTAACTTTCCCAGCCACAGGGCTGGGTGCCAGTGGTATATGTGCACATT
GTACTGCATAACTACTTCAGTTTGCAAGCGCCACACGATGACGTTAGTGCTGCAATGATGCAATCTTTTGCACGGACGGGTCTTTCCGTTAAACTGAAGA
TCACGGGGACATTGGTGTCGAGCAAACAAAATCCTCGCGACGACTCAACGATCAGTAAACCTTTAGGGGTCGCTGTTCGTATTACCTCGTGGTGAGTGCT
GGTCGTGCCTGACGCATGGAAGAAGATAGTGCACATCCATTCGCTAGTATCCTTTGCCCTTGAGCCAGTCAAAGCGGAAAGTAAAACCAGCACCTGAAAG
CAAAAATTGTTGTGGACCAATTTTAAAGAGAGAGAGAGAGCACAAACCGAAATGCTGAAGCTTATACTGCAGCACAGGAATAAGCCCGACGAAGAAACCG
CCTGTGCTGGGTAAATCTCCGTTTCGAGCACGAAAGCGAGCTGGTAAACCGGGGAAAATGAAAATTTGCGTTTCAACAGAGCGTCGAAAAGAAGCAACGA
TGCAAATTCCAATACCACAAGCAGCAACACATTTACGGTGGTCGTACGTCAGTTGCCCGCAGCTCCGGGGTAACACGCGATGTTTGGCAGTTGCTCGTGT
ATTGACTTGAAGAGCACGAAAACGTGTGGAATAACGCACTCGACGTACTCAACCAGCACAAGGTATTCGCAATGAAAGAGCAGCTGCAGTCCCTGCAAAA
CAATTTTCCTCGATACATTTGATTGTTGCTGGGACGTCGCTGCGCGTACTGAGATCGAGACCTTCAGGGAAGCTTTGGGTGTTGGCGCAACCAACGCACG
TTGCATGACTCGGGCTTTCAAACAACAAATCTTTTGCCGAAAGTCTGGAGTCCTGGATCGGCTTGAAAGTCACTCTCGTTGGCTAAAAGCGCCTGAGGAG
TCGAGCACTTGAAGTCGCTCTTCTTGTTCTCTTGCGAGTGAGTGAGGTGGACACCCCCACAGTCACGCTCCTTCCAACCCGCCGACCCCAAAACCGACGG
GGTTCTGCATCATATAAACCGGCATAGCTGGCAAATATGTAGGTTCTGCCTCGCTGCTGCCTCAGTGGGAGTTGGTGTAATAATTTTTCCGTGCATCGAG
CAGCTGAAGCAACGTCTGCGCTGACGTCTCGTAGCTCCAACAATGCCTGGCCGAAATCTGCGGCAATGAATATCATTGATAAGTACACCGACCCTGATGT
CGACATTCACACTAATACAAAAAGCTTGATAGAGAAATCGACAGTACAAGCCACAATTACAGACACAACGTCTTCCAGTTCGTGGGTTGCGCACAGCATA
AAGTGCTTTGCACCGAATTTCCAGATCGGTATGATGAAAGTTGCGATACCTTGGTAACCCGCCGGAATAAGCGTATACAGCACGGTGTAAAGCGGATAGA
CACCACAAAGTACCATCACGCAAGGAAAAATCGCTGGTATCTTTCAAAATGGCCTTTGAGTGGGGAATTCGCCGCAAACAGCTCTGGTCAGACGAACCGA
TACACCATTGGTGCAAGGAATCGAACTGGTATTGGTCCAGCTTGAAGCATGAACGGGAATGGGAATCCGATTAATTTCGCAGCTGAAGGCATATTCCTAC
AAGGGGGCCGTTCAACCCGAACGATGCAGCGAAAATCTTGCGTCCCGTGAGTTGAAGACCCGGTATAAACCTGGGCATTTGCGCGGTCACGACGCCTCCA
ATCGTCATCTCCATTAACAGCAGACGTATCCAGAAAACCAGTTTGCAGCCACTCCGTCGGACGGCGGTCGGAGCGGAGGCACTCGAGTAGGATTGCAGTA
ATCCATGCAGTAGCGGAGTAAGGAGGCAGATCAGAAACACTCGAATTCGCGACGCTGTCTTGCAGTAAGCGTCCAAAATCTGAAGACGCTCAACAGAGTA
CGAGCCCTGGCGACCCACCTGGATCCGGTTCCATTTCTCCTCAAGACGACTCCACCAGGAACTCTGTGGTTTGGTCTCACTTGCATCCCTTGATGGCGTT
GCCAGCACTACATGCAACTCTGCTGATGCCATGCCAGTATTGCATGAATGAGTATAGTCTCCGAGTCAAATAGTTCAATCAAAAGTCTTTGCGTTCCGAT
GCAACCATCGCAAGTCAAACTGTTGAGGATGGATGGGGAACACATCGTTTTTTGTGTCTTCACCAATGGTGATTCATCACATACAAACGCCAAGTGAATT
CGATAATCGCCTCATCAAATCGCATTTTTCATTTTCCTCCGACGTTCACAACTGATGCCCAAATCTCCCGTTCAAGTCCGTGCGTCCGCCTTGCTCCGCC
GCGGCCTGTGGCAACTGCGTCAAGGCCAATGCGGCGGGGCCTCTGCCACTCTGCTGCTGTTCGTGCTGGCAATTTTCTCGCTGGGGCTGTGGCTCTCTCC
GCTGTCGCAACTTTCAAACCTTCGCGCGAAATCCACGCCAGCGGTGACGCGAACGCTCTGCGCTGGGGCACGGGCGGCAACGTCGTGATCTTAAAAGGAC
AACAGTTGCAGCGCCCACTGCCGAATCGGTACCCGAACGGGGCCAATAACAAATTCCAATGTGACCTGCCGTCGCTACGGTACCAGTGCGATATGAGCGA
GGACGAGGGCTGCAACGCTTACCCGCAAATGTTCCCGTCCGCTGCACTGTTCGACAATTGGAAACCGGAAGAGACGGACCAGGTGCCGAGTGGCATCTTC
GACAGTATTTGCCATTTCAATGTTTCGGACTCGGTGAGTGGACGAGGTTGTTGGTTGTTGATGGAGAAGACTAACAATTTTGTGTTTCTTGTAGTCTGAG
TTCCGTCTGGCTCAAATGTTTCGGGAAATGGAGGTGCCGTTTGTAACCTACGGGGTGCCAGAGCTTACGGAGGCCAAGAGCGATGGACGGACGAGTATCT
GACGCGGCAGCTGGATCCGAAGGCACTGTACAAGGTGCACGTGGCTAACGACAGCCACTTTATGTACTACCTTAAGAGCAAGCAGCTTGCTGGCGAAGAG
GACCCGTACGAGTCTCGTTGGATGACGTACCCGCAGTTTGTAAAGGCTGTGCACGACGCCAAGCCGCTCGAGGAGGCCGGCGAGCCCCATGAGTATTACT
ACTTTATGCTCAAGAAGTACGATTTTTCCAAGCGAGCAGCATTCATCTACGATGAGCTGCAGTTCCTGAGCCCGCTGGAAACCGAACATGATATCCGATT
CGGGGACCTGTTTGTTCGTGACGCAGCTGCAGCCAAGGAGCGCGGCATGCGCTGTCGTTTCGGAATGAGGGGCATCATAGCAGAGGGCCATTTTGACGGC
GGGCTTAACCATATTTCCATGGTCCGTGGAACCAAGAGATACGTGATTTCGCCGCCGAGTTCCTGTAAGTGCCAGGGGTTGATGACCAAAGGCCAGTCAC
AACGACACACTTCGTTCAATTGGTCGGATACAAGTGCTCTTCCAGAGAATGCTCGTAATTGTCCTGCTGCAGAGGTCGCGCTCACGGCCGGCGAAGTTCT
GTATCTGCCGTCGTATTGGTATCATCATATTGTGTCTTTGGACACGAGCATCCAGTGCAATCTGCGTTCCGGCTTCACTATTCGAGACGACACGAAGCAA
TTTATCACTGAATGCGGCTTCAGCATCCGGAAACCGTAAGGGAGCAAGCGAACTGGTAAGCTAAGTCCATGAAATATGCACGAAGATGCTATTGCGAGTT
ATTGTGGTGTTTTGGTGGCCCTTCAGAACGACTCAAGTACTTTATAAACGTCGAAGCCTCCCTTTCAATAGTCACAAGCTGGCTGGAGATGCCGCTTAGC
GCAAGCGCTGAGGTGCCACCGTGCCTGCCACTTGAGAACTGAAGGTGAACTTGTCCTGCGAGTCGTATGTGAGCAAGCCGAACGACTTCTCGAACGCGTT
GGTCTTGTAAGGTGTGTCGAATATCTGGAAGTAGAAAGACTCGTCCATGGAGCTGCTCCACGCCTCGTACGAGCCAAAGAACGTCGCCTGGCCATCTACG
GTGCCGGTGTTGCCCGATAGTGTTCCGTCTGAAGGCCATCCCGTCTCAGTGAGGACCAGCTTGTCGCTGAAGTTGCTCTTCATGACTGTCCACTGGTCGT
TCACGACTTGAATTGCATTGCTAGCCGTCGTTCCGGGCGTGAAGTAAGGGTGGACGTTCACACCCAGTACATCACTAGCACCAACAAGATTCGACCAGCC
AGAGATACCAGAGAAGTTGATGACCTCGGTATTGCGCTGCACGGTGCCGACCTTGACCGTGCTGGGCACCTGTGCTTTGATGTCCTTGATAAGTTTGACC
ATGTCACTGGGGACGGTGGTTGCACCTGCAAGGTTCTCGTTGCCCACGAAGATGTAGCCCACGCCTCCTGCCTTGGCGGCAGCGATCGCAGCAGCCGCTT
GCACCTGGTAGTCCGACTGGGGGTACGGCACGCCCAGCGCTGACGTGAGGTTGGCGCTTGCAATGATGGGGCCAATCTGCGTGGAGCCGAACTGGGAGAT
GTACGTGCGCACAGTGGTGAAGCCGTGGCGTTTGATGATGGCCATGTCCGCAGCGACGGTAGTAGCATCCATGTTATTGCTGACGGCGTGGTGGTTCGGG
TCGTAGCAGACGCCTTTAGCACTCACTTGGGCTGCGAGCAGGGCGACACCGACGGAAAGCGGGGCGAAGAACTTCATGATGAGGTGGATGACTGTGCTGT
TGAAGGCAATTGGAAAAGTGACTTCTACTTACCCGGCCTCAAGCATAGTTCCCCAATATTTAAAGCGTGCAGATATCCAGTGGCGTGCGCCAAGTAACAG
CTCGAATTCTAAGAGAGCGCGGCGCCTTCCAGCTCATTACGTCGTACTTCGAGGACAGGCTCAGCACCGTGATATCTGTCGGTGCGCGCACGCTTGGAAC
AAGCCATGCACTGCTGAAACTCCTCGCCGAAACGGACCTGACGTCTGTCCAGAAGCCGCGAAATTCAAACCTGTTGGTGCCCTGACGATGACGCGAGCAA
GACTGTCCTGTACGCCAGTGTTGGCGATAGACCACACGACAGGCGTTGGTTGCCTGTTGAGGCACGAGTCTCGAACACCAAAAATTACAGCATGACGGGT
ATCCGGTTGGCCTCAGGAAAAGTTGACAACATTTCAGGCAAACGGCGATTTGTTACTGTGGAATTATTTTACTCGGATAGCCCAACGCAGCCTGCGTTTT
GTGGGTGTTTGTCTCCTAGCTGGCTGACGCGGTCATTCCCATTCGGAAGAAGCGACTGGCAGCGGCGCTCAGTGGAATTGGTGCGACCGAAGTTGGCACA
GGCGGATGGAACTGCTCAATGTCTTCGCAGAGCAGGTTGATGAGCGCGTCCTTGGTCAACTGGTCGTCGGGCAAATCGAACGAGAAGTCGAAAGGCTTCG
AGGACACGAGGTCATTCTCATCAAAGAACGTGGCCAAGTACGGGTGCCGCAGTGCGTCGTCCACTGAGATCCGCTTTTCAGGGTTGAATTGCAGCATCTT
GCTCAGCAAATCAATAGCCTCGGAGCTCACAGCATGTTCAGCGCCACTGCCGGCAAACACCTCTCGCCACCCTTTCGGTTTAGAGATCGCAAGCTTCGTG
AGGAAGCGCAAAGCCTTGGTGTTCTTCACAAATTCAATGTCTTCCTGCTTCGGTGTGCCCAGGAACTTGATGATGAGCTTGAGCTGGTGCAAATAGTCGT
TCCAGGGAACAGCGGCTCGCGCAGCAGCATTTCCGCAAATATACAACCCACCGCCCATACATCGATCGCTGCAGTATACTGCAAACAGTTGAGCATAATC
TCTGGCGCGCGGTACCACCGCGTAACCACGTATTCGGTCAGCTCGCCAGGCGGCGGTAGGTCCTGATGTGCTCCCGATGACGAGCCGATCCCTCCGCGAG
CAAGCCCGAAGTCACATATTTTGAGGTCACAATTTGCGTTTAATAAAATGTTGCTGGGCTTCATATCACGGTGCAGCACGCCCGCCGAGTGAATGTGATG
CAGCGCGCAGAGCATTTGGTACAAAAAGTACTTGACGTGGTCGTCCGACATTGGTTGCATGGAGTAAATGACCTGATGCAGGTCGGTCTCCATGAGTTCT
GTGATGATGTACATATCGTCAAACTGCTTTCGAGAAGGAGGAGGCACCAGATCCAGAAGTTTTGTGATATTCTTGTGACTGAAGTGTCCGAGCAGTCGAA
CCTCGCGCAAAATGCGCTTTGCGTCCACCAGGTCCTCGAAGATGTTTGTGATTTTCTTGACTGCCAGATTGTCACCGCCGTTGACTACGTCTTTGACTGC
AATGACCGCGCCGTACGCTCCATTTCCGATAGGCTTGACGAGATGATAGCAAGTATCCAAAGTAAACACCTGTCCATTTGCGTTGAAGGAGTGTGTCTGT
GGCCGCAGCACCGGTAAGAAACTGGAACTGCTGCTAGTTGCGCCGAATGCAGCCCGAGGAAGTCGGGCACGTCCATTTCCAACTGCTATTGCCGATCTTG
AACTCATTTTCAAGTACTCGTCCTCTAGCCCCACGTTCTGGTAGGCAGAAACACCTCTCCCCGCCAGAACAGCGCTCTTGTAGGGCGCCACCGAGCTCTG
TGTAGCAAGATCGCCAGCAACAGAATCCTCTTCAGAATCCTCGTCACCCTGGTTGTCCTCCTGGTTGCTGCTTTCCTTTCCATCTGCAGCATTGTTGTCA
GCATCCTGCCCCTGCGAACAGGATGACTCACTTGATCGATGCTCAGGCGTGCAGCAGTATCCGACGACTGAGTGCACTGGTAGTTCTTCATTTCCAATTA
CCAGTGCCGTGGTATCGTAGTTGTGAACTCGAGTCTGCATCTCGTGCACCGCTGGTTTCGTCTCTTCTTCGCCCTGTCCCCTGATATCTTTTCTCGCCGC
TCGAATTTCTTCTGTGGGGAGGTCTGTGTCGTTGTGGTTATTATTACTGCATTCACTGCTGGTATAGCTGACGGCACTGCCATTGCGGCCACGCTCTCTC
GTCACCAGTACACTCGCTCGTCGTCCTTCGTCCCCAAACATTGGCATGATCTTGGCTGGTTCCGTCACTGGCCACGCTGCCGCCTCCCCGAGTCGGTATT
GCGTCTCCGCCTGGGAGACCAACGTGTCAATGCACGAACGCAGCACCTGCATCCATTGTGCAAGCATATTTTCATCCCCAGCAGCTAGTCGCAGTACGAG
TGACGTTCTCTCTGCACAGTCTTCACCTTCTCCTGCGATATCTGTGCGCTGGTCAGCGGACGCCAGCTGAAGCTCAAGCGCGTGTTTTACCTGTCGATGA
GATCTCAGCTCCGTCACGACGTCGTTCTGCGACAGCGTGACGATAGACACGAGTCGTCCGGGCTTCCTGCTCTCGGCCAAGAAGCGGAACTGTCTCAACG
TGAACCGGAGCTGGCTGCCTGCACCGCTGTCCAGTGTTTGCTCCAGCACCAAGTAGCAAGGCTTGGAGCGCCAGTAGCGCTGCTGCAGGAGCTCGGTGAG
TACGCCCTCGAGCAGGACCTGCGCGGCGTCGGAGCGGGGCGTGAGCGCCTCCGTCTTGCTGTCGGCACTTCTGCTGCTGCGCTGCAGACTGAGCGACCGC
AGCAGCGCGCGCATGGGTGAGTCCACGTGCGTCTTGGTCTCTTCTTCTTCTCCATACAGAGTGCGGATCGAATCGTTGAGCGGTTGCGGCGCCATGGGCG
ACTGTTGCTCTTTACGCCGGAACAGTCGCGCCAGCAGCGTCTGAGAGCGAAGACCGCCGCCGCTGCCTGGACCTGCAGGCACAGGGGACGACACTCGATG
CAGACGCGCGGAGAGGGACGAAGGGGCCGACAGGGGCGAGCGCGAGGGAGGTTGCCGCGTCATGGCGCAGAGGGAATGGGATAGTGGCAGCAACTATTCA
AGATTTCGACTGAAAAGACGCAAACGTACTGGACACTTCTAAAAGTAGCTAACGCGCAGAGATTCGACCAATCCGAGTGCAGTATTCCGATCGAGCCAAT
CAGAAACGACAGAGGAAGACCACTTCAACTTGGTTTCTCCGCCCTACTTGGTTCTCCGCCCTACTCCTGCAGAAACGGGTAGTCGGTGTATCCCCGCTCG
TCGCCGAGGTAGAACGTGTCGGCGTCGTAGTCGTTCACGGGCTTGTTGAGCTGGAAGCGACGCACCAGGTCCGGATTCGAGATGAAATGTCGACCAATGG
CCACGGCGTCGGCGGCGCCCTCCTCGACGATGTGCACGGCCGACTGCCGGTCGAAGCCCGACGCAGTGATGAGCACGCCCTTGTACGTGTCTCGGAACTG
CCGAGCGGAGCCTTTCTCGGGCGCCAGCGGGTTGCGCACGTGGTAGCCGCGCGGCTCGATGAGGTGCGCGTAGGCCAGGTCGTAGTCGTTGAGCTTGTTG
AGTACGTACGTGTACGTGGCGATCGGGTCCGAGTCCTTGTCGCCGAAACTGGCGCCGAACGGGGACAACCGGATGCCCACCTTGGTCGAGTCCAGGCTCT
CCAGAATGGCCTCTAGCGCCTCGAACAAGAAGCGCGCGCGGTTCTCCGCACTGCCCCCATACTGGTCCGTGCGGTTGTTGATGCCGTCGTGCAGGAACTG
CTCCAGTAAGTACCCATTGGCACCGTGCAACTCGACGCCGTCGAACCCCGCAGCGATCGCGTTCTCCGCCGCCTTGCGGTAGTCCGCCACGATACCAGGG
ATCTCCTTGGCCTCGAGCGTGCGCGCCGGCACAGGCTCCTTGAGGCCTTCACGGGTCCGGATCTTCTTGCCGGCGCGGATATTCTCCATCTTGGAGCTGG
ACGACACTGGCAGGATGCCGTCCGGCTGGTTCAGCGGGTGGCTCATGCGGCCCGTGTGCCACAGCTGGAGGAACATCTTACCGCCTTTGTCGTGCACCGC
CTGCGTGACGTGGCGCCAGGCCGCGACTTGCTCGGGCGTGAAGATGCCCGGCGAGCCCCAGGCCCCGCGCGCCGAGGGAGAAATGTTGGTGGCCTCGGCG
ATGATGAGGCCGCCGGGCGTCGCGCGCTGCTTGTAGTACTCAACGCCCATGGGCTTCTGCGCGCCTTCCTCTTCCGTGCGCGAGCGCGTGAGCGGCGCCA
TCACCACGCGGTGCAGCAGCTGAATAGGGCTCTTCTTGCCACCGAGCGTCAGCGGCGTGAAAAGCTTGGGCGTCGTCATAGCGGGCGAGTAGCGAAAGGA
GAAGTGAGCAGCAGCAGCGTCCACGCATCAGAGCTTGCGTCATCCCGCGAGTCGTGTCATCCCGCCTCGAACATCGAAAGGCCATGATCTTTTTCATCCT
GGACACCTTCTCGAAGGTGTCGAGCTGTGCTGGGAGCGATAGCAGCGATCATCGGGCCCCCTGCCTCCATGCAGGCAAATACAGCGCTCAGCTAGAGCTG
TCGCCGTAGCATCGCCAGAATGTTGGCTTCAAGTTGCCTTCTGTCTCGTTAAGTATCCGTTAAGTACACGAACGTAATCATCCTTGTGTCAGTCTCCAAT
CTCATTCCCTCAAGTGCTTCGCGGCCGGCATGGGGCAGCGCTTCAGCACCTCGCGCGAGAGCGACGTCTCGGAGGAAGGAGGTCTTCCCTCCCCTCCTGC
ATCACCCATCCCCCTATCCTCAGATCGCCCGCTTCTCCCTGTGCAGCAGGACGAGCACATGCGGCTGGGCGACGTGGTGCACGACACGCTCTCCGTCTCC
CAAGAGCCGCCCTACCAGCCTCAGAGCGACTCGTTCCCGTCGGACAACGCCCTCCCGCTCACAAGACGCAGCTCCATGGCCAAGCCCCCCAAACTCTCGC
GCTTCCGGCCGTCCATGGATCTCCCCAAGCCCGCAGGCTCCCCGCAGTCCGGGTACTTGTCCAGCTCGGACTCGCGCTCGCTGGACTCGAGCTCGAGCTC
CAGCGACGAGGACCTCGTGGGCAGCGGAGAGGAACTCGTGAACGACTGGCTGGACGAGCCGGAGGACGCCGTGCTGTCGCCACTCGCGCAGCCCAAACGC
ACACGCCACGCGAGCGCCTGCTCGTCCGTGTCCTCCCACACAGGCAACAGCGTGTCCTTCTCGGCCATGCACAGCAGCGGCGGACGCAACAGCAATAGCA
GCCAGCACAGCCTCACGGGGTGGGCCTCGTGGCTCAGCTCCCCAGACGATGTGGAAGAAGAGGAAGAGGCGACGAGGAACCCGTAGCCCTCACGCCTTTC
TTGCGCGACAACATGCCCGTGTATGAGATCATGAGACAGGTGCAGCTCTTTCGGAACTTGAGTCAGATGCAGCAAGAGCAAGTGGTGCGCGCGCTCAAGC
CGGCCAAGTTCTCGGACGGGGAAGTCATCGTGGCGCAGGGGACGCGCGGCTCTCGCTTCTACATGATTGCCAAGGGAGAAGCGGTCGTCACCAAGACAGT
CATTGCCAGTAGTCACAGTATCACTGGATCCACCCCTTCGAGTGCAGCGAAGACCCAGGAGCGCATGATGACGCACTTGCGAGCGGGTCACTACTTCGGC
GAGTTGGCGCTGATTTACGACGACCCGCGCACAGCCACCGTGCGCGCTGTTGGAGACGTTGAACTCTTGTACTTGACGCAGGAGGACTTCCAACACATTG
GACAGGTGCATCTGAGTCTGATGCTGCAGCAAGTGCCGTTGCTCGCGAGGTTGAGTGCACGCGACCAGGATATTGTGCTGAAGTGCTTGCGCCCTGCAAA
CTTCAGCGACGGAGAGTATATCGTGCACCAAGGAGATGAAGGCACGCGGTTCTACATGATTACGCGGGGCGAGGCTATTGTGTCGGAAAAAGCGTGGGAC
CGGATAAAAAGCCGTACGAGAAGGAGTTGACACGGTTGTACGAGGGTCACGTGTTTGGCGAAATGTCGCTCATCTACAGCGAGCCGCGTACAGCTTCAGT
GCGTGCTGTGGGCCCGGTCAAATGTCTGTACCTGAGTAAGGAGGACTTCGACAAGTGTCTTCTGTCCGATCATTTCCAGCGGTTTATTCAAGAGGCGTAC
GTTGAGAAGGCCACGCGACGCGCAATGCGATTACGGCTACAGCAGCGTGCTAACAGTGCCGCGACGATGGCCTCTACACCTCAAACAAGCTCCGGAGCTG
ACAGCTCGTCTGGTTCTATCGTGGCGCCGCCGCCTGCACCTACGTCACCCGTGAAGGCAACTGAAACGAAGAAGCTTGTGAAGCAGCGGCTTAAGAACGG
AGAGGTCGTGGTGAACAAGTATGTGATCAAGGGTGACTTGGGTCGAGGTACGTTTGGCCGCGTGAAACTCTGTGAAAGCCAGAAGGACGGGCAGATGTAC
GCTGTGAAGATCATGCACAAGACTTTTGTTCAGCGTATGGCTGGCAAGGAGGATCAGCTCTACGATGTGCTGCGCCGCGAGGTTGCCATCATGAAAAAGC
TCAACCATCGCAACGTTGTGAGACTTGTCGAGGTGATTGACGATCCCAACAGCCAGAAAATGTATCTGGTGCAGGAATATGTGCAGCACAGCCTTATGGA
GGAGGTCACACAAGCAAGACGACTCAACGAGCCGGTGGCACGGAAGTACATGCGCGATCTTCTCACCGGGCTTCAGTATTTGCACTTCCACAAAGTCATC
CACCGCGACATCAAGCCGGAAAACATTCTTGTCAGCTCCGATGGGGTGGCCAAGATTGCCGATTTCGGTACGGCGCGTATGATCATGAACGAGACAGAGA
CCATTTCTGGTGCAAAGGGTACCCCCGCTTTCATGGCACCCGAGATGTTCGATATCGATGCTACGTATCAAGGCCCCGCTGTCGACGTGTGGTCGCTCGG
TGCAACACTTTATATGATGGTTATTGGCCACCCGCCGTGGATGGCAGATAACGAGATCGTTTTGGCGGAGCGTGTGCAGCGCATGGAATTACGCTTTCCG
AAGGACGTGGAACGCACGATGGAGCCGCATTTGAAGAATTTGCTGCAACGAATGCTCACTAAAGACCCAGCTTTGCGCATCTCACTGAAGGAATGCTTTA
TACACGAGTGGACCACGAAGGAGGGCAGTGAGCCGCTTGGTATGCTCACTTCTGAGAAATCTCTGACGGTCTCAATGGATGAGAGTGAACGCGCTATTGA
GAACATTCCGGAGCGCATTGACCAGCGACTGACGGAGAGTCTTGCACAGGCCCATCAGCTGGTGAAGACCCGGCAGGAAAGTGTCGGTCCTGGAGTTGTG
CGTACAAACAGTGGCCGCTATTTTACTGGTACACCCGTGTCGGGTACCTTGGGCTCACGCATTCCATCATCTGCATCAACGACGTCTTCTATTACTACAG
TCAGCAGTTCAACATCGATCAGTCCAAGCCGTGCGTCAAGCGAAGAAGTGTCACGTATTATCTGCGCTTGGCGCCACCACAAGCGTGTGCAGCTCATGGA
TGGTCATAAGGAGCTCTCTGAGCGTTCTCGTGAGCTGCTGATTGAGCAAAAGCGCATGGCATTCTCGGTGGATCGAGCGAAGGTGACTGAGATTATCTTA
CCTGCTGCGAAGCCGACTTCTCGCAGCCGCTATCCAAGCGCAGCGTCTTCTTCGTCCCTCCGCCAAGTGCGAGAGCAATCTGTATTATCATCGTCGTCAT
CAGTCTCGTCGATGTCTACAGTCGGTGGCGATACTCCTTCGTCCGTAGACTCGCCAAGGACACGCTCATTCCCTACGGGACGAAGCAATTCAGTGGACAA
CTCGCTGCTGGCGAAGAAGAACAGTTTCCGCAGTCGAAGCCACAAGGACTCAGGCAACCTGGAAGGCTTCGGGCGCACATCATTCACGTCTGTATCGCAG
TTATCAGAGCTAGCAGCAATCCCCGTCGAGGACAACCTTGACCAGCGCGGCAGTTTGTCATCGTCCAGCGAAGCAGGGAGCATTGGGCATTCCAGCAGCA
GCAACTTGTCGAACACAAGCTCTTCAGACGCAGACCTGATGAAGCGCTCACTTTCGCGCAAAAAGGACTTCCTGATGGTTACGTCTGAGGTTTTCCGGGA
TGATGCTGGAGACTATCAGACTCGCAAGATTCTGTTCCAGGCACGCGACGACGATTTCTCGGTGGCTTCGCGTGTACCTACCCACTCGAACTCAGGTCGT
GAATTACTTCCACCCGGCCGCGCAGGCTCAACCAACTCATCATCGTCAAGTCAAAAGCCCAGGAGATTAGGAAGCGCCGGCAAGCTGGGGAGCACGAGCA
AGTTGGGAAGTTTGAGCAAGTTGGGAAGTGCAGGCAGCGGGAGTGCCATGAGTAGTGCTATGGGCAGTGCCATGGGCAGTGCCATGGGCAGTGCTATGGG
CAGTGCTATGGGCAGTGCGTTCTCAAAGGTGCTACGAGTCGCCGATCCTCTCACGGAAGTGCCGGCTCCATTAGCAGCTCCTCACGTTCTGTGGTCACTG
ATGATGGCAACATTGAGGAGTTTGATATGGAAGGTATCGACTGTGTGCAAGTGACGGAGATTGATGATGAAGATGACGACGAACCCATGCATCGCGGAAG
TATGCACAAGAACAGTGGAGCCTCCTCTCGACATTTCCACCTCCACGCGAGTGACAGTAGTCGTGCCAACAGCAGCCATAATCGTAGCCACTCGTCTCAA
GGTACCGGTATGGACGGGCTGTCAGATGCTGACAGCGACTCTGACGACTCGGATTATTCCGATGTGGAGTGCGATGTGGATGTGGACGCAACGTTCAGCG
AGCTTATTGCGTCGCCTAACCAACTTGACCTCATCAGCCATGATGATGAGGAGATTGCTCCTATCGTGACGGCAAAACCGTCGCTAACATCACTGCTGGG
CTCCTCGTCTTCCTCACTCGATGTGGATAACAGCGGCAATGTTCTCACTCTCGGGTCGCTGGCATCGATGGCTTCTGGCGCTTCAGCGCTGTCAATGGCA
ACGCCTGCCACGTTGCCGGATATTGTTCAGGTCTACGTGAGCAGCAAGATTCGCGAAAACCTCACTCTCTCGATCCGGTCTGGCTATGCTGAGGCGAAGG
GGGCGCGCTCGTACATGGAGGACCGAAGTACAGGGCAGACGACGTGCGATCTGTCACGTTACCCTGTTGCGCTTGCGGACACGTACGCCTCACTGGCATT
CTTCGCAGTATATGATGGTCACAACGGTACCGATACGGCTGTGAAGCTGCAAAATGAGCTGCACCACCGCTTCTTTGCTGAAGGTGCGGGCTTCGTCGAG
TCTCCTGTGAGCTGCATTTCGTCGGTCTGCGAGGCAGTTGACAACGAAATTCTGGAGCAGCAGAACCGGAGCGTTCTTCCGAAACGCAAGCGGACAATGG
CCCCGGACGAGTTGCGGCGCTACCTTCGTAGCGAAGCTGCCGATGAACGGACCCCAGTCTTCTGGAAGGCGAGTGCTGCGAAATTGACGGCGAAATTGTT
TGCGGAGAGGAGATGAAAGCCCAGCTGCAGCCTATCTCGTTCTCTGGTGCTGCAAGTGTTTTCGCTGTGGCCGTTAAGCAGCGTAAGAAACGTCGGCGCA
CAGCTGGTGACAAGGAAGGAGACGCAGAATCGGAGGAAGGCGAAGACGATGAGGATGTCAAGGTGGTGGAGGACGAAGAGGATCTAGAAGGAGAAGACCA
GCCCACTCTGGTTTACGTGGCTAACGTGGGTGACTGCCGTGCCGTTTTGTGCACTGCGGACGCGCAAGCCATCGACTTGACGACAGACCACAAGGCGTCT
CTCCCGGCGGAACAAGAGCGCATTGAGGCTTCTGGTGGCTTTGTGCACAATGGCCGGCTTGATGGCATTCTGCAGATCTCGCGAGGCTTTGGTGACTTGG
CGCACAAGCAGGATGGCCACTTGGTGGTCACACCCGACGTGGTGGAGCACGTGGTGCACCCCTCGGACCAGTTCCTGCTGCTTGCGAGTGACGGCCTCTT
CGACGTTCTGACATCTCAGCAGGCCGTGAACTTTGTGCTGCGCAAGCTCCAGACCCACGGCGACGTGCAGCTAGCAGCGCAGGAGCTGGTGCTCAAGTCG
CAGGCCTACTTTGCGCACGACAACGTCAGCGTCGTCATCGTAGCGTTGAACCAGAAGGGCGACGCCTGAAATGGACGTCGGCCTCTGTCACCAAGTGCGG
AGGATCGGAGACCGACGAAAAAGCAGAAGGACCATGACAAGTGAGACCCAAGGATTAAAAGGAGTGTAATGAGCCGGCAGCGCTGGAGCCCGTACGCCGT
TCGAAGCCTTCCGATGGACTCGTGCGGAGCTCGCGTCATGGCTGTGAATTAGTATACGTTCGAGTGCCCTGCATAATTTATCTTCTCTATGGTTTAGCGT
TTGCTCCAGAGCTGGCGACGGAGGCATCTTCCCAGTCGAGTTCGTCCCACGAACGGAGCTCATCCTGCTCCTCCAGCACGCACACAGGCGACGGCAAGTC
GCTCATCGAGCGCATTGACGACGTGTGGCTGTGGTCGTCCGTGGTGTCTGCATAGGCAGCGTCGAGCTCATCGATCGTCATGAGCGTCGTGGCGTTGTCA
GGCCTCGCGGCCATCTGCGTCATCTCGTTGAGTAGGAAGGGCACCGCCCCACCGCCAAAGGCCCCCGGGGTCCCTCGATACGGCTCGCGCTCGAGCGTGA
AGAAGGTCCTCAATTGCACTGCGAAGCCCAGCGCTACGAGTGGGCAGCGGCGCGTCGATGGGTTGGTCGCGAGCGCCAACAGGCCCTGAAGGTATTGGAA
GAACTGCTCTGCGCGTTGCTGAACGATTTTGGGGCTCTTGGACCCCCAGAGTCTCCGCTTGGGGAAGTACTTGGCGCTCAACTTGTCCAGCGCGTCAACC
ATGGGCGCGCAGTGCGAGCAGTGGGCGTTCTTTTTGTCGATGGCGGCTCCCGGGTGGTTGCGTCGGTCGAACACCCGTGCGAGTTCGTCCCGCAGCGACC
TGAACCCTGAGTACCGTCTCGAGACGACCCACCGCTCGCCTACGCTGGCGACCATCGAGTCCTCGAGCACGAGCTCGTACTCTGTGTGGGTGCCTGGCGA
CACGATCGACGTGTACTGCAGGATGGACGACTCCCGTGGCGTGACGGAGTGCAGAACGAATCCCCCGAGATGGTTGGCCAGGCTCCTGGGCCGCTTCTTG
CTGGACTTGATCGACATAGACGACGAGCTGGACGTCGAGCGGGGCAGTGGCCTGCTGGGCCTGTTGAGCTGGTCGCCGTCGCGATTGAGCGCGACGCTAG
TGCGGCGCAGGTCCGCGAGCACGGGCTCGTCCCAGCTCACGGCCTTGTGCGAGGTGTCGGGCGAGGACGGCGAGTCCAGGAAGAAGGACAGGACAGCGTC
GGAGACGGGCGCTGACATGGGCGGCAACCGCCGGCGCGGCGGCTTGAGCGGCTTCTCCTCCATTGGCAGCGGATTCACGTATGGCAAGGCGTGAGTGACG
AGGGGAACGCCAGATGCTGTGGCGGACCTGGGCGGAGATCCGCAGCAAGTGCAGCGCATCCCCCTCGGGTCACGGAGTGGGATCCAATCTGTCAGCGAGT
GCAGACATACGTGTATAGCCAGGCGCTGAACCCAACTACCGTCGTCTTTTCAATAGTTAACTAAATTTACTGAATCGATTTCAAGGTATCATATGGTGAA
ATTAAAAATGTTTAGCTCATTGAAATGTATTGTATGATGTGATCGGATATGGAAGGGGATGTAGGATTGAAAGTGCGCTTACTGTAACGCAAGGACAATC
AGGCGGCATAACGCCACAAAGGCAAAGGATTTGCCCTGGGCATTTGCTTTTGTTGGCGCTGCCATGGATACATGTAGGGAGAGAGGGCATCGCTACACGT
AGGCTTTGACTTCCAGCAGAGAGCAATCGAGGTCGCGCTGGCAAAAATTCGACGGTCTCCAGCTGGGGAACGGCAACGCGGCACAGCAATTTTGAAGCCT
CAACTGGCTGTGTAGGCGAAGATACAGCTCATTGACTTGTTATCGAGGGCGATTGCGATGCCTATCGCTGGTTCGTCGTCTCCAACACTCCAAGTCGAGG
ATGAGAAAGCGTCGCAACGAGCTCACGCGATGAGTCCCGTGCAAGTCGGTAGAGTTAACCACGGTCCATGCAGCGCTCGTGGCGTGCAGAGACCCAGCGC
TTTCCCATGGGAATGCTCCACCAACAATTGTCCACGGTTTTTGCTTTCTTGTGCTGGTTGTGCCCCCCCCCCCCCCTGCAGTGCAAGGCTTGCATGGCAT
TGCCATGATGGCAAGAGCTGGGAGAGAGTCTTGCGTCACCAACGGAAAGAATCGCTACGTAATGGATCGCGTCGCCCAAAGCTTTGGCTGCGTGGCGATC
CATCCGGGCATGTTGACTTGACTCGAATTGGGTTCATCGTGGGAAACTAGGGATATTGCCGGAGCACGCACAGAGACCGACCGGCTCGCCTCCACCGAGA
TGGATCGGTCATCGATTCGGCGCGAACGCACTGCGTCCAGCGAGGCTATCACGCAGAGCAAGCAGACAGCTTGCCATTCAGCCGGCTTTGGATTCATAGG
ACAACTTGTGCGGCCGCTTCCACGAGCGCCGGGCGATCGCACCACATGTCGTCAAGAGGTCTCTGCAAAACCGTTCGCAGTGTCGACTTCGGTGAGAGCT
CTCAGCAGTCCGGGAAATCGTTGCGGTATCAGTGCTGTGCTGTTTAGAGCAAATTGTTTGGCAACTCGTTGTCTGCGTCGTAGTTCGCGGGAGCCACAAG
TGCCTGCTGGTCCGTGACTCCGTAGAACTCCAATACAGTCTGCACTTTGTGGCCTCAGCTGGTGGCCACTGCCGTCGTAGCTCGGTGTCTGAACGAAAAG
CCCCACTCCACACGACGCAGGATGAACTGACTGCAGAGACATTCTACCAATGGCTACATGGATGTCATACATCCGAGCGAGGCAGGCGCAATGAGCTCAA
AGGCAAATCTCTCGCTAGCTGATGCTTGCCATGCAACAAGCACCGAGACTCGGCAGCTTCGCCTCCAACAACGGCCCGCCGCCCCCCGCTCCATCCAAAT
GCCCTCGCCCAGTCGCCGCCGCCGGGCTTTCCATTAGTGCCCACTTCACTTCGTGCAACGAAGTATCCCTAGTCAATATTATCCTATGGGTAGAATCCAG
CAGCTACCTGTACCTAACATTGCCGTTGTGAGGCTCACGTCTTCCAGTTGACATTTAGCGAGATGCAGGCCTTAGCAACGCTTTCGCTGCTATTGCCAAC
GGCGGCCACCATCGCCCAGGCTACAATGGAAGCGGTCGAAGTTTACTCCGGTAGCAACTGCGCCGGACCCCGGGGTCGTGGCCATGACCAGCAATGACGA
CTGCACGTACTCCACCTGCAACTCGACCAACTTTGGCAACGACACGTTCTACCTGTCCACCGTTTGCACCAGTTCGAGCACCTTTGACTTCGCCGCCGTA
GCGTTCACTGAATTCAACTTCGTCGTCGTCGAGTACTACCAACGAGGCGCCGAGTGTGCGGCCGCCAACTTGACGGAGACCGACGCCTTCCCAGCGTCCG
GGAGCTGCCAGATCGCCTCCAGCGTCGGGACGTCATCGGTCATCGCGAGTCTGTACTCGAATGGGTCGCTCACCGTTTCGTACTACAGCAACGACGCCTG
TGGGGGCGACAGCTTCTACGTCTTCGCCTTGGACAGCGCCAATGTGTCGAGTGGCGACTGTATCGACGGAGCGTACAAGGTCTACTCGAGTGATAGTCCC
AACGGAATTGTGGGGAGTAGTAGCACTTCGGTCAGCTCCAGTCAGGCTACCGGCAGTAGCAGTGGCAGTGGCCTTGACACGGAGTCGGCTGCTCCAGTCT
TAGTACTGGCGGTGTTATAGGCATCATTGTTGCTGCGGTGGTGGCTGTGGTGCTTCTCGCCATTATGTTATTGTGGTACCGACGCCGGGCCAAGAAGGAC
AAAGGTTCGTCTCCGTTTACTGGAGGGAACAACCGCGAGGAAGACGCTTATGCGGGCGTGGTGTCCCCGACTACAGGCCATAAGAGCTCCGTCTCGGGCA
CGACAGTGAACGACTCGAACTCGCTTGGCTTGGGGCCAAAAAGCCTCGCGGGGCTTTGGGACGATGAAATTATTGCTACTGCTCGTATTCCGCGTGAAAA
AGTGTTGGTCCAGCAATTGATCAGTCGAGGAGGCTATGGCGAGGTTTACTACGGACTGTTTAACGGACTGCACATCGCAGTCAAGATGCTGCTGCCCGAG
ACCCGCAAGAGCGTCAAGCACGTGAACGATTTCCTCGCTGAAGTGAAAATGATGGCGACGCTCGACCACCCGCGTATTGTCAAGTTCGTGGGCGTGGCTT
GGGACTCGCTCACAGACCTTTGTGTCGTGTCGGAGTACATGGAAGGTGGAGACCTCCGCGCTCTCCTCTCGTCGTACGAAGCGCAAAATCACCCTGTGGG
CTTCGACCGGAGCAAAGTTACCATCGCGCTGCACGTCGCCCATGCGCTCACGTACCTGCACTCGCTGGACCCGCCAGTCCTGCACCGTGATCTCAAGTCC
AAGAACATCCTGCTCAGCTCCGAGTTGGAAGCGAAGGTCACGGACTTTGGCATCTCCCGCGAAAGGATTGACAAGACCATGACTGCCGGTGTAGGCACGT
CGCTGTGGATGGCGCCCGAGGTGATGATAGGCGAGAGGTACGACGACAAGGCCGACATCTTCTCGTTCGGTGTGGTGCTGTCGGAGCTCGACCAGCACGC
ACTTCCGTACTCGCACGCGAAGGACGCCAGCAATTCCGGTCGGAAGATGCCCGACACGGCCATTCTGCAGATGGTGGCGTTGGGCAAACTTCGCGTGAAG
TTCTCGCCCAAAGCGTTGGAGTCGATGGTGGCGTTGGCGAGTTCGTGTGTGGCAGTGGACCCGAAGGAGCGGCCAACTGCCGCCGAGGCCTTATACAAGC
TGCAAACGATTTTGCGCCA