Description :
From Genome Similarity Track
Location :
contig_42:49577- 69896
Transcript NameFunction/comments
g9023.t1RAW27810.1 hypothetical protein PC110_g15793 [Phytophthora cactorum
g9024.t1RAW27811.1 hypothetical protein PC110_g15792 [Phytophthora cactorum
g9025.t1XP_008904795.1 CMGC/MAPK protein kinase [Phytophthora parasitica INRA-310
g9026.t1ETI47774.1 hypothetical protein F443_08059 [Phytophthora parasitica P1569
g9027.t1hypothetical protein
g9028.t1hypothetical protein
g9029.t1RAW27818.1 hypothetical protein PC110_g15789 [Phytophthora cactorum
g9030.t1hypothetical protein

Sequence
20319 bases(100 bases per row)
CTGCACCGTAGCCACTTTGCAAGCCACCGACAGGTTCGAGAACCGCACTTCCAGTTGCGGTTGCGTCCGTCCAAACGCTGTCTCGAACTTGTTGGCGACG
GACTCGTAGAATACTTGGGCTTCCGTGGTGGTTACCGCCTTTGCCGGGACGAAGTTGGGCTGACCAAACTCGGCTCAACACTGGAGTTTTCCATCGCTTC
AAACTCTCGCTTGGAAGTGAATTGGAAAGTGGTGTGCTGCTTGTTTGCCGTCACGGCTTGTGAGTCGTAAGGTGCTGGAGATCATGATTATGCAGAAACC
TGCGAAATCTGGTGTTGATGGTGGCAGCAGCGGCGGCGAGTGCCGTTTGATGTAACTTTCCCAGCCACAGGGCTGGGTGCCAGTGGTATATGTGCACATT
GTACTGCATAACTACTTCAGTTTGCAAGCGCCACACGATGACGTTAGTGCTGCAATGATGCAATCTGTTGCACGGACGGGTCTTTCCGTTAAACTGAAGA
TCACGGGGACATTGGTGTCGAGCAAACAAAATCCTCGCGACGACTCAACGATCAGTAAACCTTTAGGGGTCGCTGTTCGTATTACCTCGTGGTGAGTGCT
GGTCGTGCCTGACGCATGGAAGAAGATAGTGCACATCCATTCGCTAGTATCCTTTGTCCTTGAGCCAGTCAAAGCGGAAAGTAAAACCAGCACCTGAAAG
CAAAAATTGTTGTGGACCAATTTTAAAGAGAGAGAGAGAGCACAAACCGAAATGCTGAAGCTTATACTACAGCACAGGAATAAGCCCGACGAAGAAACCG
CCTGTGCTGGGTAAATCTCCGTTTCGAGCACGAAAGCGAGCTGGTAAACCGGGGAAAATGAAAATTTGCGTTTCAACAGAGCGTCGAAAAGAAACAACGA
TGCAAATTCCAATACCACAAGCAGCAACACATTTACGGTGGTCGTACGTCAGTTGCCCGCAGCTCCGGGGTAATACGCGATGTTTGGCAGTTGCTCGTGT
ATTGACTTGAAGAGCACGAAAACGTGTGGAATAACGCACTCGACGTACTCAACCAGCACAAGGTATTCGCAATGAAAGAGCAGCTGCAGTCCCTGCAAAA
CAATTTTCCTCGATACATTTGATTGTTGCTGGGACGTCGCTGCGCGTACTGAGATCGAGACCTTCAGGGAAGCTTTGGGTGTTGGCGCAACCAACGCACG
TTGCATGACTCGGGCTTTCAAACAACAAATCTTTTGCCGAAAGTCTGGAGTCGTGGATCGGCTTGAAAGTTACTCTCGCTGGCTAAAAGCGTCTGAGGAG
TCGAGCACTTGAAGTCGCTCTTCTTGTTCTCTTGCGAGTGAGTGAGGTGGACACCCCCACAGTCGCGCTCCTTTCAACCCGCCGACCCCAAAACCGACGG
GGTTCTGCATCATATAAACCGGCATAGCTGGCAAATATGTAGGTTCTGCCTCGCTGCTGCCTCAGTGGGAGTTGGTGTAATAATTTTTCCGTGCATCGAG
CAGCTGAAGCAACGTCTGCGCTGACTTCTCGTAGCTCCAACAATGCCTGGACGAAATCTGCGGCAATGAATATCATTGATAAGTACACCGACCCTGATGT
CGACATTCACACTAATACAAAAAACTTGATAGAGAAATCGACAGTACAAGCCACAATTACAGACACAACGTCTTCCAGTTCGTGGGTTGCGCACAGCATA
AAGTGCTTTGCACCGAATTTCCAGATCGGTATGATGAAAGTTGCGATACCTTGGTAACCCGCCGGAATAAACGTATACAGCGCGGTGTAAAGCGGATAGA
CACCACAAAGTACCATCACGCAAGGAAAAATCGCTGGTATCTTTCAAAATGGCCTTTGAGTGGGGAATTCGCTGCAAACAGCTCTGGTCAGACGAACCGA
TACACCATTGGTGCAAGGAATCGAACTGGTATTGGTCCAGCTTGAAGCATGAACGGGAATGGGAATCCGATTAATTTCGCAGCTGAAGGCATATTCCTAC
AAGGGGGTCGTTCAACCTGAACGATGCAGCGAAAATCTTGCGTCCCGTGAGTTGAAGACCCGGTATAAACCTGGGCATTTGCGCGGTCACGACGCCTCCA
ATCGTCATCTCCATTAACAGCAGACGTGTCCAGAAAACCAGTTTGCAGCCACTCCGTCGGACGGCGGTCGGAGCGGAGGCACTCGAGTAGGATCGCAGTA
ATCCATGCAGTAGCGGAGTAAGGAGGCAGATCAGAAACACTCGAATTCGCGACGCTGTCTTGCAGTAAGCGTCCAAAATCTGAAGACGCTCAACAGAGTA
CGAGCCCTGGCGACCCACCTGGATCCGGTTCCATTTCTCCTCAAGACGACTCCACCAGGAACTCTGTGGTTTGGTCTCACTTGCATCCCTTGATGGCGTT
GCCAGCACTACATGCAACTCTGCTGATGCCATGCCAGTATTGCATGAATGAGTATAGTCTCCGAGTCAAATAGTTCAATCAAAAGTCTTTGCGTTCCGAT
GCAACCATCGCAAGTCAAACTGTTGAGGATGGATGGGGAACACATCGTTTTTTGTGTCTTCACCAATGGTGATTCATCACATACAAACGCCAAGTGAATT
CGATAATCGCCTCATCAAATCGCATTTTTCATTTTCCTCCGACGTTCACAACTGATGCCCAAATCTCCCGTTCAAGTCCGTGCGTCCGCCTTGCTCCGCC
GCGGCCTGTGGCAACTGCGTCAAGGCCAATGCGGCGGGGCCTCTGCCACTCTGCTGCTGTTCGTGCTGGCAATTTTCTCGCTGGGGCTGTGGCTCTCTCC
GCCGTCGCAACTTTCAAACCTTCGCGCGAAATCCACGCCAGCGGTGACGCGAACGCTCTGCGCTGGGGCACGGGCGGCAACGTCGTGATCTTAAAAGGAC
AACAGTTGCAGCGCCCACTGCCGAATCGGTACCCGAACGGGGCCAATAACAAATTCCAATGTGACCTGCCGTCGCTACGGTACCAGTGCGATATGAGCGA
GGACGAGGGCTGCAACGCTTACCCGCAAATGTTCCCGTCCGCTGCACTGTTCGACAATTGGAAACCGGAAGAGACGGACCAGGTGCCGAGTGGCATCTTC
GACAGTATTTGCCATTTCAATGTTTCGGACTCGGTGAGTGGACGAGGTTGTTGGTTGTTGATAGAGAAGACTAACAATTTTGTGTTTCTTGTAGTCTGAG
TTCCGTCTGGCTCAAATGTTTCGGGAAATGGAGGTGCCGTTTGTAACCTACGGGGTGCCAGAGCTTACGGAGGCCAAGAGCGATGGACGGACGAGTATCT
GACGCGGCAGCTGGATCCGAAGGCGCTGTACAAGGTGCACGTGGCTAACGACAGCCACTTTATGTACTACCTTAAGAGCAAGCAGCTTGCTGGCGAAGAG
GACCCGTACGAGTCTCGTTGGATGACGTACCCGCAGTTTGTAAAGGCTGTGCACGACGCCAAGCCGCTCGAGGAGGCCGGCGAGCCCCATGAGTATTACT
ACTTTATGCTCAAGAAGTACGATTTTTCCAAGCGAGCAGCATTCATCTACGATGAGCTGCAGTTCCTGAGCCCGCTGGAAACCGAACATGATATCCGATT
CGGGGACCTGTTTGTTCGTGACGCAGCTGCAGCCAAGGAGCGCGGCATGCGCTGTCGTTTCGGAATGAGGGGCATCATAGCAGAGGGCCATTTTGACGGC
GGGCTTAATCATATTTCCATGGTCCGTGGAACCAAGAGATACGTGATTTCGCCGCCGAGTTCCTGTAAGTGCCAGGGGTTGATGACCAAAGGCCAGTCAC
AACGACACACTTCGTTCAATTGGTCGGATACAAGTGCTCTTCCAGAGAATGCTCGTAATTGTCCTGCTGCAGAGGTGGCGCTCACGGCCGGAGAAGTTCT
GTATCTGCCGTCGTATTGGTATCATCATATTGTGTCTTTGGACACGAGCATCCAGTGCAATCTGCGTTCCGGCTTCACTATTCGAGACGACACGAAGCAA
TTTATCACTGAATGCGGCTTCAACATCCGGAAACCGTAAGGGAGCAAGCGAACTGGTAAGCTAAGTCCATGAAATATGCACGAAGATGCTATTGCGAGTT
ATTGTGGTGTTTTGGTGGCCCTTCAGAACGACTCAAGTACTTTATAAACGTCGAAGCCTCCCTTTCAATAGTCACAAGCTGGCTGGAGATACCGCTTAGC
GCAAGCGCTGAGGTGCCACCGTGCCTGCCACTTGAGAACTGAAGGTGAACTTGTCCTGCGAGTCGTATGTGAGCAAGCCGAACGACTTCTCGAACGCGTT
GGTCTTGTAAGGTGTGTCGAATATCTGGAAGTAGAAAGACTCGTCCATGGAGCTGCTCCACGCTTCGTACGAGCCAAAGAACGTCGCCTGGCCATCTACG
GTGCCGGTGTTGCCCGATAGTGTTCCGTCTGAAGGCCATCCCGTCTCAGTGAGGACCAGCTTGTCGCTGAAGTTGCTCTTCATGACTGTCCACTGGTCGT
TCACGACTTGAATTGCATTGCTAGCCGTCGTTCCGGGCGTGAAGTAAGGGTGGACGTTCACACCCAGTACATCACTAGCACCAACAAGATTCGACCAGCC
AGAGATACCAGAGAAGTTGATGACCTCGGTATTGCGCTGCACGGTGCCGACCTTGACCGTGCTGGGCACCTGTGCTTTGATGTCCTTGATAAGTTTGACC
ATGTCACTGGGGACGGTGGTTGCACCTGCAAGGTTCTCGTTGCCCACGAAGATGTAGCCCACGCCTCCTGCCTTGGCGGCAGCGATCGCAGCAGCCGCTT
GCACCTGGTAGTCCGACTGGGGGTACGGCACGCCCAGCGCTGACGTGAGGTTGGCGCTTGCAATGATGGGGCCAATCTGCGTGGAGCCGAACTGGGAGAT
GTACGTGCGCACAGTGGTGAAGCCGTGGCGTTTGATGATGGCCATGTCCGCAGCGACGGTAGTAGCATCCATGTTATTGCTGACGGCGTGGTGGTTCGGG
TCGTAGCAGACGCCTTTAGCACTCACTTGGGCTGCGAGCAGGGCGACACCGACGGAAAGCGGGGCGAAGAACTTCATGATGAGGTGGATGACTGTGCTGT
TGAAGGCAATTGGAAAAGTGACTTCTACTTACCCGGCCTCAAGCATAGTTCCCCAATATTTAAAGCGTGCAGATATCCAGTGGCGTGCGCCAAGTAACAG
CTCGAATTCTAAGAGAGCGCGGCGCCTTCCAGCTCATTTCGTCGTACTTCGAGGACAGGCTCAGCACCGTGATATCTGTCGGTGCGCGCACGCTTGGAAC
AAGCCATGCACTGCTGAAACTCCTCGCCGAAACGGACCTGACGTCTGTCCAGAAGCCGCGAAATTCAAACCTGTTGGTGCCCTGACGATGACGCGAGCAA
GACTGTCCTGTACGCCAGTGTTGGCGATAGACCACACGACAGGCGTTGGTTGCCTGTTGAGGCACGAGTCTCGAACACCAAAAATTACAGCATGACGGGT
ATCCGGTTGGCCTCAGGAAAAGTTGACAACATTTCAGGCAAACGGCGATTTGTTACTGTGGAATTATTTTACTCGGATAGCCCAACGCAGCCTGCGTTTT
GTGGGTGTTTGTCTCCTAGCTGGCTGACGCGGTCATTCCCATTCGGAAGAAGCGACTGGCAGCGGCGCTCAGTGGAATTGGTGCGACCGAAGTTGGCACA
GGCGGATGGAACTGCTCAATGTCTTCGCAGAGCAGGTTGATGAGCGCGTCCTTGGTCAACTGGTCGTCGGGCAAATCGAACGAGAAGTCGAAAGGCTTCG
AGGACACGAGGTCATTCTCATCAAAGAACGTGGCCAAGTACGGGTGCCGCAGTGCGTCGTCCACTGAGATCCGCTTTTCAGGGTTGAATTGCAGCATCTT
GCTCAGCAAATCAATAGCCTCGGAGCTCACAGCATGTTCAGCGCCACTGCCGGCAAACACCTCTCGCCACCCTTTCGGTTTAGAGATCGCAAGCTTCGTG
AGGAAGCGCAAAGCCTTGGTGTTCTTCACAAATTCAATGTCTTCCTGCTTCGGTGTGCCCAGGAACTTGATGATGAGCTTGAGCTGGTGCAAATAGTCGT
TCCAGGGAACAGCGGCTCGCGCAGCAGCATTTCCGCAAATATACAACCCACCGCCCATACATCGATCGCTGCAGTATACTGCAAACAGTTGAGCATAATC
TCTGGCGCGCGGTACCACCGCGTGACCACGTATTCGGTCAGCTCGCCAGGCGGCGGTAGGTCCTGATGTGCTCCCGATGACGAGCCGATCCCTCCGCGAG
CAAGCCCGAAGTCACATATTTTGAGGTCACAATTTGCGTTTAATAAAATGTTGCTGGGCTTCATATCACGGTGCAGCACGCCCGCCGAGTGAATGTGATG
CAGCGCGCAGAGCATTTGGTACAAAAAGTACTTGACGTGGTCGTCCGACATTGGTTGCATGGAGTAAATGACCTGATGCAGGTCGGTCTCCATGAGTTCT
GTGATGATGTACATATCGTCAAACTGCTTTCGAGAAGGAGGAGGCACCAGATCCAGAAGTTTTGTGATATTCTTGTGACTGAAGTGTCCGAGCAGTCGAA
CCTCGCGCAAAATGCGCTTTGCGTCCACCAGGTCCTCGAAGATGTTTGTGATTTTCTTGACTGCCAGATTGTCACCGCCGTTGACTACGTCTTTGACTGC
AATGACCGCGCCGTACGCTCCATTTCCGATAGGCTTGACGAGATGATAGCAAGTATCCAAAGTAAACACCTGTCCATTTGCGTTGAAGGAGTGTGTCTGT
GGCCGCAGCACCGGTAAGAAACTGGAACTGCTGCTAGTTGCGCCGAATGCAGCCCGAGGAAGTCGGGCATGTCCATTTCCAACTGCTATTGCCGATCTTG
AACTCATTTTCAAGTACTCGTCCTCTAGCCCCACGTTCTGGTAGGCAGAAACACCTCTCCCCGCCAGAACAGCGCTCTTGTAGGGCGCCACCGAGCTCTG
TGTAGCAAGATCGCCAGCAACAGAATCCTCTTCAGAATCCTCGTCACCCTGGTTGTCCTCCTGGTTGCTGCTTTCCTTTCCATCTGCAGCATTGTTGTCA
GCATCCTGCCCCTGCGAACAGGATGACTCACTTGATCGATGCTCAGGCGTGCAGCAGTATCCGACAACTGAGTGCACTGGTAGTTCTTCATTTCCAATTA
CCAGTGCCGTGGTATCGTAGTTGTGAACTCGAGTCTGCATCTCGTGCACCGCTGGTTTCGTCTCTTCTTCGCCCTGTCCCCTGATATCTTTTCTCGCCGC
TCGAATTTCTTCTGTGGGGAGGTCTGTGTCGTTGTGGTTATTATTACTGCATTCACTGCTGGTATAGCTGACGGCACTGCCATTGCGGCCACGCTCTCTC
GTCACCAGTACACTCGCTCGTCGTCCTTCGTCCCCAAACATTGGCATGATCTTGGCTGGTTCCGTCACTGGCCACGCTGCCGCCTCCCCGAGTCGGTATT
GCGTCTCCGCCTGGGAGACCAACGTGTCAATGCACGAACGCAGCACCTGCATCCATTGCGCAAGCATATTTTCATCCCCAGCAGCTAGTCGCAGTACGAG
TGACGTTCTCTCTGCACAGTCTTCACCTTCTCCTGCGATATCTGTGCGCTGGTCAGCGGACGCCAGCTGAAGCTCAAGCACGTGTTTTACCTGTCGATGA
GATCTCAGCTCCGTCACGACGTCGTTCTGCGACAGCGTGACGATAGACACGAGTCGTCCGGGCTTCCTGCTCTCGGCCAAGAAGCGGAACTGTCTCAACG
TGAACCGGAGCTGGCTGCCTGCACCGCTGTCCAGTGTTTGCTCCAGCACCAAGTAGCAAGGCTTGGAGCGCCAGTAGCGCTGCTGCAGGAGCTCGGTGAG
TACGCCCTCGAGCAGGACCTGCGCGGCGTCGGAGCGGGGCGTGAGCGCCTCCGTCTTGCTGTCGGCACTTCTGCTGCTGCGCTGCAGACTGAGCGACCGC
AGCAGCGCGCGCATGGGTGAGTCCACGTGCGTCTTGGTCTCTTCTTCTTCTCCATACAGAGTGCGGATCGAATCGTTGAGCGGTTGCGGCGCCATGGGCG
ACTGTTGCTCTTTACGCCGGAACAGTCGCGCCAGCAGCGTCTGAGAGCGAAGACCGCCGCCGCTGCCTGGACCTGCAGGCACAGGGGACGACACTCGATG
CAGACGCGCGGAGAGGGACGAAGGGGCCGACAGGGGCGAGCGCGAGGGAGGTTGCCGCGTCATGGCGCAGAGGGAATGGGATAGTGGCAGCAACTATTCA
AGATTTCGACTGAAAAGACGCAAACGTACTGGACACTTCTAAAAGTAGCTAACGCGCAGAGATTCGACCAATCCGAGTGCAGTATTCCGATCGAGCCAAT
CAGAAACGACAGAGGAAGACCACTTCAACTTGGTTTCTCCGCCCTACTTGGTTCTCCGCCCTACTCCTGCAGAAACGGGTAGTCGGTGTATCCCCGCTCG
TCGCCGAGGTAGAACGTGTCGGCGTCGTAGTCGTTCACGGGCTTGTTGAGCTGGAAGCGACGCACCAGGTCCGGATTCGAGATGAAATGTCGACCAATGG
CCACGGCGTCGGCGGCGCCCTCCTCGACGATGTGCACGGCCGACTGCCGGTCGAAGCCCGACGCAGTGATGAGCACGCCCTTGTACGTGTCTCGGAACTG
CCGAGCGGAGCCTTTCTTGGGCGCCAGCGGGTTGCGCACGTGGTAGCCGCGCGGCTCGATGAGGTGCGCGTAGGCCAGGTCGTAGTCGTTGAGCTTGTTG
AGTACGTACGTGTACGTGGCGATCGGGTCCGAGTCCTTGTCGCCGAAACTGGCGCCGAACGGGGACAACCGGATGCCCACCTTGGTCGAGTCCAGGCTCT
CCAGAATGGCCTCTAGCGCCTCGAACAAGAAGCGCGCGCGGTTCTCCGCACTGCCCCCATACTGGTCCGTGCGGTTGTTGATGCCGTCGTGCAGGAACTG
CTCCAGTAAGTACCCATTGGCACCGTGCAACTCGACGCCGTCGAACCCCGCAGCGATCGCGTTCTCCGCCGCCTTGCGGTAGTCCGCCACGATACCAGGG
ATCTCCTTGGCCTCGAGCGTGCGCGCCGGCACAGGCTCCTTGAGGCCTTCACGGGTCCGGATCTTCTTGCCGGCGCGGATATTCTCCATCTTGGAGCTGG
ACGACACTGGCAGGATGCCGTCCGGCTGGTTCAGCGGGTGGCTCATGCGGCCCGTGTGCCACAGCTGGAGGAACATCTTACCGCCTTTGTCGTGCACCGC
CTGCGTGACGTGGCGCCAGGCCGCGACTTGCTCGGGCGTGAAGATGCCCGGCGAGCCCCAGGCCCCGCGCGCCGAGGGAGAAATGTTGGTGGCCTCGGCG
ATGATGAGGCCGCCGGGCGTCGCGCGCTGCTTGTAGTACTCAACGCCCATGGGCTTCTGCGCGCCTTCCTCTTCCGTGCGCGAGCGCGTGAGCGGCGCCA
TCACCACGCGGTGCAGCAGCTGAATAGGGTTCTTCTTGCCACCGAGCGTCAGCGGCGTGAAAAGCTTGGGCGTCGTCATAGCGGGCGAGTAGCGAAAGGA
GAAGTGAGCAGCAGCAGCGTCCACGCATCAGAGCTTGCGTCATCCCGCGAGTCGTGTCATCCCGCCTCGAACATCGAAAGGCCATGATCTTTTGCATCCT
GGACACCTTCTCGAAGGTGTCGAGCTGTGCTGGGAGCGATAGCAGCGATCATCGGGCCCCCTGCCTCCATGCAGGCAAATACAGCGCTCAGCTAGAGCTG
TCGCCGTAGCATCGCCAGAATGTTGGCTTCAAGTTGCCTTCTGTCTCGTTAAGTATCCGTTAAGTACACGAACGTAATCATCTTTGTGTCAGTCTCCAAT
CTCATTCCCTCAAGTGCTTCGCGGCCGGCATGGGGCAGCGCTTCAGCACCTCGCGCGAGAGCGACGTCTCGGAGGAAGGAGGTCTTCCCTCCCCTCCTGC
ATCACCCAGCCCCCTATCCTCAGATCGCCCGCTTCTCCCTGTGCAGCAGGACGAGCACATGCGGCTGGGCGACGTGGTGCACGATGCGCTCTCCGTCTCC
CAAGAGCCGCCCTACCAGCCTCAGAGCGACTCGTTCCCGTCGGACAACGCCCTCCCGCTCACAAGACGCAGCTCCATGGCCAAGCCCCCCAAACTCTCGC
GCTTCCGGCCGTCCATGGATCTCCCCAAGCCCGCAGGCTCCCCGCAGTCCGGCTACTTGTCCAGCTCGGACTCGCGCTCGCTGGACTCGAGCTCGAGCTC
CAGCGACGAGGACCTCGTGGGCAGCGGAGAGGAACTCGTGAACGACTGGCTGGACGAGCCGGAGGACGCCGTGCTGTCGCCACTCGCGCAGCCCAAACGC
ACGCGCCATGCGAGCGCCTGCTCGTCCGTGTCCTCCCACACAGGCAACAGCGTGTCCTTCTCGGCCATGCACAGCAGCGGCGGACGCAACAGCAATAGCA
GCCAGCACAGCCTCACGGGGTGGGCCTCGTGGCTCAGCTCCCCAGACGATGTGGAAGAAGAGGAAGAGGCGACGAGGAACCCGTAGCCCTCACGCCTTTC
TTGCGCGACAACATGCCCGTGTATGAGATCATGAGACAGGTGCAGCTCTTTCGGAACTTGAGTCAGATGCAGCAAGAGCAAGTGGTGCGCGCGCTCAAGC
CGGCCAAGTTCTCGGACGGGGAAGTCATCGTGGCGCAGGGGACGCGCGGCTCTCGCTTCTACATGATTGCCAAGGGAGAAGCGGTCGTCACCAAGACAGT
CATCGCCAGTAGTCACAGTATCACTGGATCCACCCCTTCGAGTGCAGCGAAGACCCAGGAGCGCATGATGACGCACTTGCGAGCGGGTCACTACTTCGGC
GAGTTGGCGCTGATTTACGACGACCCGCGCACAGCCACCGTGCGCGCTGTTGGAGACGTTGAACTCTTGTACTTGACGCAGGAGGACTTCCAACACATTG
GACAGGTGCATCTGAGTCTGATGCTGCAGCAAGTGCCGTTGCTCGCGAGGTTGAGTGCACGCGACCAGGATATTGTGCTGAAGTGCTTGCGCCCTGCAAA
CTTCAGCGACGGAGAGTATATTGTGCACCAAGGAGACGAAGGCACGCGGTTCTACATGATTACGCGGGGCGAGGCTATTGTGTCGGAAAAAGCGTGGGAC
CGGATAAAAAGCCGTACGAGAAGGAGTTGACACGGTTGTACGAGGGTCACGTGTTTGGCGAAATGTCGCTCATTTACAGCGAGCCGCGTACAGCTTCAGT
GCGTGCTGTGGGCCCGGTCAAATGTCTGTACCTGAGTAAGGAGGACTTCGACAAGTGTCTTCTGTCCGATCATTTCCAGCGGTTTATTCAAGAGGCGTAC
GTTGAGAAGGCCACGCGACGCGCAATGCGATTGCGGCTACAGCAGCGTGCTAACAGTGCCGCGACGATGGCCTCTACACCTCAAGCAAGCTCCGGAGCTG
ACAGCTCGTCTGGTTCTATCGTGGCGCCGCCGCCTGCGCCTACGTCACCCGTGAAGGCAACTGAAACGAAGAAGCTTGTGAAGCAGCGGCTTAAGAACGG
AGAGGTCGTGGTGAACAAGTATGTGATCAAGGGTGACTTGGGTCGAGGTACGTTTGGCCGCGTGAAACTCTGTGAAAGCCAGAAGGACGGGCAGATGTAC
GCTGTGAAGATCATGCACAAGACTTTTGTTCAGCGTATGGCTGGCAAGGAGGATCAGCTCTACGATGTGCTGCGCCGCGAGGTTGCCATCATGAAAAAGC
TCAACCATCGCAACGTTGTGAGACTTGTCGAGGTGATTGACGATCCCAACAGCCAGAAAATGTATCTGGTGCAGGAATATGTGCAGCACAGCCTTATGGA
GGAGGTCACACAAGCAAGACGACTCAACGAGCCGGTGGCACGGAAGTACATGCGCGATCTTCTCACCGGGCTTCAGTATTTGCACTTCCACAAAGTCATC
CACCGCGACATCAAGCCGGAAAACATTCTTGTCAGCTCCGATGGGGTGGCCAAGATTGCCGATTTCGGTACGGCGCGTATGATCATGAACGAGACAGAGA
CCATTTCTGGTGCAAAGGGTACCCCCGCTTTCATGGCACCCGAGATGTTCGATATCGATGCTACGTATCAAGGCCCCGCTGTCGACGTGTGGTCGCTCGG
TGCAACACTTTATATGATGGTTATTGGTCACCCGCCGTGGATGGCAGATAACGAGATCGTTTTGGCGGAGCGTGTGCAGCGCATGGAATTACGCTTTCCG
AAGGACGTGGAACGCACGATGGAGCCGCATTTGAAGAATTTGCTGCAACGAATGCTCACTAAAGACCCAGCTTTGCGCATCTCACTGAAGGAATGCTTTA
TACACGAGTGGACCACGAAGGAGGGCAGTGAGCCGCTTGGTATGCTCACTTCTGAGAAATCTCTGACGGTCTCAATGGATGAGAGTGAACGCGCTATTGA
GAACATTCCGGAGCGCATTGACCAGCGACTGACGGAGAGTCTTGCACAGGCCCATCAGCTGGTGAAGACCCGGCAGGAAAGTGTCGGTCCTGGAGTTGTG
CGTACAAACAGTGGCCGCTATTTTACTGGTACACCCGTGTCGGGTACCTTGGGCTCGCGGATTCCATCATCTGCATCAACGACGTCTTCTATTACTACAG
TCAGCAGTTCAACATCGATCAGTCCAAGCCGTGCGTCAAGCGAAGAAGTGTCACGTATTATCTGCGCTTGGCGCCACCACAAGCGTGTGCAGCTCATGGA
TGGTCATAAGGAGCTCTCTGAGCGTTCTCGTGAGCTGCTGATTGAGCAAAAGCGCATGGCATTCTCGGTGGATCGAGCGAAGGTGACTGAGATTATCTTA
CCTGCTGCGAAGCCGACTTCTCGCAGCCGCTATCCAAGCGCAGCGTCTTCTTCGTCCCTCCGCCAAGTGCGAGAGCAATCTGTATTATCATCGTCGTCAT
CAGTCTCGTCGATGTCTACAGTCGGTGGCGATACTCCTTCGTCCGTAGACTCGCCAAGGACACGCTCATTCCCTACGGGACGAAGCAATTCAGTGGACAA
CTCGCTGCTGGCGAAGAAGAACAGTTTCCGCAGCCGAAGCCACAAGGACTCAGGCAACCTGGAAGGCTTCGGGCGCACATCATTCACGTCTGTATCGCAG
TTATCAGAGCTAGCAGCAATCCCCGTCGAGGACAACCTTGACCAGCGCGGCAGTTTGTCATCGTCCAGCGAAGCAGGGAGCATTGGGCATTCCAGCAGCA
GCAACTTGTCGAACACAAGCTCTTCAGACGCAGACCTGATGAAGCGCTCACTTTCGCGCAAAAAGGACTTCCTGATGGTTACGTCTGAGGTTTTCCGGGA
TGATGCTGGAGACTATCAGACTCGCAAGATTCTGTTCCAGGCACGCGACGACGATTTCTCGGTGGCTTCGCGTGTACCTACCCACTCGAACTCAGGTCGT
GAACTACTTCCACCCGGCCGCGCAGGCTCAACCAACTCATCATCGTCAAGTCAAAAGCCCAGGAGATTAGGAAGCGCCGGCAAGCTGGGGAGCACGAGCA
AGTTGGGAAGTTTGAGCAAGTTGGGAAGTGCAGGCAGCGGGAGTGCCATGAGTAGTGCTATGGGCAGTGCCATGGGCAGTGCCATGGGCAGTGCCATGGG
CAGTGCTATGGGCAGTGCGTTCTCAAAGGTGCTACGAGTCGCCGATCCTCTCACGGAAGTGCTGGCTCCATTAGCAGCTCCTCACGTTCTGTGGTCACTG
ATGATGGCAACATTGAGGAGTTTGATATGGAAGGTATCGACTGTGTGCAAGTGACGGAGATTGATGATGAAGATGACGACGAACCCATGCATCGCGGAAG
TATGCACAAGAACAGTGGAGCCTCCTCTCGACATTTCCACCTCCACGCGAGTGACAGTAGTCGTGCCAACAGCAGCCATAATCGTAGCCACTCGTCTCAA
GGTACCGGTATGGACGGGCTGTCAGATGCTGACAGCGACTCTGACGACTCGGATTATTCCGATGTGGAGTGCGATGTGGATGTGGACGCAACGTTCAGCG
AGCTTATTGCGTCGCCTAACCAACTTGACCTCATCAGCCATGATGATGAGGAGATTGCTCCTATCGTGACGGCAAAACCGTCGCTAACATCACTGCTGGG
CTCCTCGTCTTCCTCACTCGATGTGGATAACAGCGGCAATGTTCTCACTCTCGGGTCGCTGGCATCGATGGCTTCTGGCGCTTCAGCGCTGTCAATGGCA
ACGCCTGCCACGTTGCCGGATATTGTTCAGGTCTACGTGAGCAGCAAGATTCGCGAAAACCTCACTCTCTCGATCCGGTCTGGCTATGCTGAGGCGAAGG
GGGCGCGCTCGTACATGGAGGACCGAAGTACAGGGCAGACGACGTGCGATCTGTCACGTTACCCTGTTGCGCTTGCGGACACGTACGCCTCACTGGCATT
CTTCGCAGTATATGATGGTCACAATGGTACCGATACGGCTGTGAAGCTGCAAAATGAGCTGCACCACCGCTTCTTTGCTGAAGGTGCGGGCTTCGTCGAG
TCTCCTGTGAGCTGCATTTCGTCGGTCTGCGAGGCAGTTGACAACGAAATTCTGGAGCAGCAGAACCGGAGCGTTCTTCCGAAACGCAAGCGGACAATGG
CCCCGGACGAGTTGCGGCGCTACCTTCGTAGCGAAGCTGCCGATGAACGGACCCCAGTCTTCTGGAAGGCGAGTGCTGCGAAATTGACGGCGAAATTGTT
TGCGGAGAGGAGATGAAAGCCCAGTTGCAGCCTATCTCGTTCTCTGGTGCTGCAAGTGTTTTCGCTGTGGCCGTTAAGCAGCGTAAGAAACGTCGGCGCA
CAGCTGGTGACAAGGAAGGAGACGCAGAATCGGAGGAAGGCGAAGACGATGAGGATGTCAAGGTGGTGGAGGACGAAGAGGATCTAGAAGGAGAAGACCA
GCCCACTCTGGTTTACGTGGCTAACGTGGGTGACTGCCGTGCCGTTTTGTGCACTGCGGACGCGCAAGCCATCGACTTGACGACAGACCACAAGGCGTCT
CTCCCGGCGGAACAAGAGCGCATTGAGGCTTCTGGTGGCTTTGTGCACAATGGCCGGCTTGATGGCATTCTGCAGATCTCGCGAGGCTTTGGTGACTTGG
CGCACAAGCAGGATGGCCACTTGGTGGTCACACCCGACGTGGTGGAGCACGTGGTGCACCCCTCGGACCAGTTCCTGCTGCTTGCGAGTGACGGCCTCTT
CGACGTTCTGACATCTCAGCAGGCCGTGAACTTTGTGCTGCGCAAGCTCCAGACCCACGGCGACGTGCAGCTAGCAGCGCAGGAGCTGGTGCTCAAGTCG
CAGGCCTACTTTGCGCACGACAACGTCAGCGTCGTCATCGTAGCGTTGAACCAGAAGGGCGACGCCTGAAATGGACGTCGGCCTCTGTCACCAAGTGCGG
AGGATCGGAGACCGACGAAAAAGCAGAAGGACCATGACAAGTGAGACCCAAGGATTAAAAGGAGTGTAATGAGCCGGCAGCGCTGGAGCCCGTACGCCGT
TCGAAGCCTTCCGATGGACTCGTGCGGAGCTCGCGTCATGGCTGTGAATTAGTATACGTTCGAGTGCCCTGCATAATTTATCTTCTCTATGGTTTAGCGT
TTGCTCCAGAGCTGGCGACGGAGGCATCTTCCCAGTCGAGTTCGTCCCACGAACGGAGCTCATCCTGCTCCTCCAGCACGCACACAGGCGACGGCAAGTC
GCTCATCGAGCGCATTGACGACGTGTGGCTGTGGTCGTCCGTGGTGTCTGCATAGGCAGCGTCGAGCTCATCGATCGTCATGAGCGTCGTGGCGTTGTCA
GGCCTCGCGGCCATCTGCGTCATCTCGTTGAGTAGGAAGGGCACCGCCCCACCGCCAAAGGCCCCCGGGGTCCCTCGATACGGCTCGCGCTCGAGCGTGA
AGAAGGTCCTTAATTGCACTGCGAAGCCCAGCGCTACGAGTGGGCAGCGGCGCGTCGATGGGTTGGTCGCGAGCGCCAACAGGCCCTGAAGGTATTGGAA
GAACTGCTCTGCGCGTTGCTGAACGATTTTGGGGCTCTTGGACCCCCAGAGTCTCCGCTTGGGGAAGTACTTGGCGCTCAACTTGTCCAGCGCGTCAACC
ATGGGCGCGCAGTGCGAGCAGTGGGCGTTATTTTTGTCGATGGCGGCTCCCGGGTGGTTGCGTCGGTCGAACACCCGCGCGAGTTCGTCCCGCAGCGACC
TGAACCCTGAGTACCGTCTCGAGACGACCCACCGCTCGCCTACGCTGGCGACCATCGAGTCCTCGAGCACGAGCTCGTACTCTGTGTGGGTGCCTGGCGA
CACGATCGACGTGTACTGCAGGATGGACGACTCCCGTGGCGTGACGGAGTGCAGAACGAATCCCCCGAGATGGTTGGCCAGGCTCCTGGGCCGCTTCTTG
CTGGACTTGATCGACATAGACGACGAGCTGGACGTCGAGCGGGGCAGTGGCCTGCTGGGCCTGTTGAGCTGGTCGCCGTCGCGATTGAGCGCGACGCTAG
TGCGGCGCAGGTCCGCGAGCACGGGCTCGTCCCAGCTCACGGCCTTGTGCGAGGTGTCGGGCGAGGACGGCGAGTCCAGGAAGAAGGACAGGACAGCGTC
GGAGACGGGCGCTGACATGGGCGGCAACCGCCGGCGCGGCGGCTTGAGCGGCTTCTCCTCCATTGGCAGCGGATTCACGTATGGCAAGGCGTGAGTGACG
AGGGGAACGCCAGATGCTGTGGCGGACCTGGGCGGAGATCCGCAGCAAGTGCAGCGCATCCCCCTCGGGTCACGGAGTGGGATCCAATCTGTCAGCGAGT
GCAGACTTACGTGTATAGCCAGGCACTGAACCCAACTACCGTCGTCTTTTCAATAGTTAACTAAATTTACTGAGTCGATTTCAAGGTATCATATGGTGAA
ATTAAAAATGTTTAGCTCATTGAAATATATTGTATGATGTGATCGGATATGGAAGGGGATGTAGGATTGAAAGTGCGCTTACTGTAACGCAAGGACAATC
AGGCGGCATAACGCCACAAAGGCAAAGGATTTGCCCTGGGCATTTGCTTTTGTTGGCGCTGCCATGGATACATGTAGGGAGAGAGGGCATCGCTACACGT
AGGCTTTGTCTTCCAGCAGAGAGCAATCGAGGTCGCGCTGGCAAAAATTCGACGGTCTCCAGCTGGGGAACGGCAACGCGGCACAGCAATTTTGAAGCCT
CAACTGGCTGTGTAGGCGACGATACAGCTCATTGACTTGTTATCGAGGGCGATTGCGATGCCTATCGCTGGTTCGTCGTCTCCAACACTCCAAGTCGAGG
ATGAGAAAGCGTCGCAACGAGCTCACGCGATGAGTCCCGTGCAAGTCGGTAGAGTTAACCACGGTCCATGCAGCGCTCGTGGCGTGCAGAGACCCAGCGT
TTTCCCACGGGAATGCTCCACCAACAATTGTCCACGGTTTTTGCTTTCTTGTGCTGGTTGTGCCCCCCCCCCCCCCTGCAGTGCAAGGCTTGCATGGCAT
TGCCATGATGGCAAGAGCTGGGGGAGAGTCTTGCGTCACCAATGGAAAGAATCGCTACGTAATGGATCGCGTCGCCCAAAGCTTTGGCTGCGTGGCGATC
CATCCGGGCATGTTGACTTGACTCGAATTGGGTTCATCGTGGGAAACTAGGGATATTGCCGGAGCACGCACAGAGACCGACCGGCTCGCCTCCACCGAGA
TGGATCGGTCATCGATTCGGCGCGAACGCACTGCGTCCAGCGAGGCGATCACGCAGAGCAAGCAGACAGCTTGCCATTCAGCCGGCTTTGGATTCATAGG
ACAACTTGCGCGGCCGCTTCCACGAGCGCCGGGCGATCGCACCACATGTCGTCAAGAGGTCTCTGTAAAACCGTTCGCAGCGTTGACTTCGGTGAGAGCT
CTCAGCAGTCCGGGAAATCGTTGCGGTATCAGTGCTGTGCTGTTTTGAGCAAATTGTTTGGCAACTCGTTGTCTGCGTCGTAGTTCGCGGGAGCCACAAG
TGCCTGCTGGTCCGTGACTCCGTAGAACTCCAATACAGTCTGCACTTTGTGGCCTCAGCTGGTGGCCACTGCCGTCGTAGCTCGGTGTCTGAACGAAAAG
CCCCACTCCACACGACGCCGGATGAACTGACTGCAGAGACATTCTACCAATGGCTACATGGATGTCATACATCCGAGCGAGGCAGGCGCAATGAGCTCAA
AGGCAAATCTCTCGCTAGCTGATGCTTGCCATGCAACAAGCACCGAGACTCGGCAGCTTCGCCTCCAACAACGGCCCGCCGCCCCCCGCTCCATCCAAAT
GCCCTCGCCCAGTCGCCGCCGCCGGGCTTTCCATTAGTGCCCACTTCACTTCGTGCAACGAAGTATCCCTAGTCAATATTATCCTATGGGTAGAATCCAG
CAGCTACCTGTACCTAACATTGCCGTTGTGAGGCTCACGTCTTCCAGTTGACATTTAGCGAGATGCAGGCCTTAGCAACGCTTTCGCTGCTATTGCCAAC
GGCGGCCACCATCGCCCAGGCTACAATGGAAGCGGTCGAAGTTTACTCCGGCAGCAACTGCGCCGGACCCCGGGGTCGTGGCCATGACCAGCAATGACGA
CTGCACGTACTCCACCTGCAACTCGACCAACTTTGGCAACGACACGTTCTACCTGTCCACCGTTTGCACCAGTTCGAGCACCTTTGACTTCGCCGCCGTA
GCGTTCACTGAATTCAACTTCGTCGTCGTCGAGTACTACCAACGAGGCGCCGAGTGTGCGGCCGCCAACTTGACGGAGACCGACGCCTTCCCAGCGTCCG
GGAGCTGCCAGATCGCCTCCAGCGTCGGGACGTCATCGGTCATCGCGAGTCTGTACTCGAATGGGTCGCTCACCGTTTCGTACTACAGCAACGACGCCTG
TGGGGGCGACAGCTTCTACGTCTTCGCCTTGGACAGCGCCAATGTGTCGAGTGGCGACTGTATCGACGGAGCGTACAAGGTCTACTCGAGTGATAGTCCC
AACGGAATTGTGGGGAGTAGTAGCACTTCGGTCAGCTCCAGTCAGGCTACCGGCAGTAGCAGTGGCAGTGGCCTTGATACGGAGTCGGCTGCTCCAGTCT
TAGTACTGGCGGTGTTATAGGCATCATTGTTGCTGCGGTGGTGGCTGTGGTGCTTCTCGCCATTATGTTATTGTGGTACCGACGCCGGGCCAAGAAGGAC
AAAGGTTCGTCTCCGTTTACTGGAGGGCACAACCGCGAGGAAGACGCTTATGCTGGCGTGGTGTCCCCGACTACAGGCCATAAGAGCTCCGTCTCGGGCA
CGACAGTGAACGACTCGAACTCGCTTGGCTTGGGGCCAAAAAGCCTCGCGGGGCTTTGGGACGATGAAATTATTGCTACTGCTCGTATTCCGCGTGAAAA
AGTGTTGGTCCAGCAATTGATCAGTCGAGGAGGCTATGGCGAGGTTTACTACGGACTGTTTAACGGACTGCACATCGCAGTCAAGATGCTGCTGCCCGAG
ACCCGCAAGAGCGTCAAGCACGTGAACGATTTCCTCGCTGAAGTGAAAATGATGGCGACGCTCGACCACCCGCGTATTGTCAAGTTCGTGGGCGTGGCTT
GGGACTCGCTCACAGACCTTTGTGTCGTGTCGGAGTACATGGAAGGTGGAGACCTCCGCGCTCTCCTCTCGTCGTACGAAGCGCAAAATCACCCTGTGGG
CTTCGACCGGAGCAAAGTTACCATCGCGCTGCACGTCGCCCATGCGCTCACGTACCTGCACTCGCTGGACCCGCCAGTCCTGCACCGTGATCTCAAGTCC
AAGAACATCCTGCTCAGCTCCGAGTTGGAAGCGAAGGTCACGGACTTTGGCATCTCCCGCGAAAGGATTGACAAGACCATGACTGCCGGTGTAGGCACGT
CGCTGTGGATGGCGCCCGAGGTGATGATAGGCGAGAGGTACGACGACAAGGCCGACATCTTCTCGTTCGGTGTGGTGCTGTCGGAGCTCGACCAGCACGC
ACTTCCGTACTCGCACGCGAAGGACGCCAGCAATTCCGGTCGGAAGATGCCCGACACGGCCATTCTGCAGATGGTGGCGTTGGGCAAACTTCGCGTGAAG
TTCTCGCCCAAAGCGTTGGAGTCGATGGTGGCGTTGGCGAGTTCGTGTGTGGCAGTGGACCCGAAGGAGCGGCCAACTGCCGCCGAGGCCTTATACAAGC
TGCAAACGATTTTGCGCCA